Incidental Mutation 'R7045:Hjurp'
ID547232
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene NameHolliday junction recognition protein
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R7045 (G1)
Quality Score217.468
Status Not validated
Chromosome1
Chromosomal Location88262471-88277633 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT at 88266278 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
Predicted Effect probably benign
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127446
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1 A T 12: 112,662,301 Y18* probably null Het
Ank2 C A 3: 127,012,744 A583S probably damaging Het
Atp8b4 T C 2: 126,372,195 N706S probably benign Het
Bace2 A G 16: 97,399,665 N111S probably damaging Het
Cnp A T 11: 100,580,358 R275S probably benign Het
Cs T A 10: 128,352,717 M104K probably benign Het
Ctcfl G A 2: 173,112,374 T310I probably damaging Het
Cyp2d40 T C 15: 82,761,562 I81V probably benign Het
Ddx19a A G 8: 110,993,074 V30A probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dock6 G A 9: 21,821,811 A1062V probably damaging Het
Dpysl2 T C 14: 66,829,946 D172G probably benign Het
Eml2 A G 7: 19,201,579 D638G probably damaging Het
Epb41l4b C A 4: 57,103,522 A105S possibly damaging Het
Fam198a T C 9: 121,965,641 L287P probably damaging Het
Fat4 A G 3: 38,888,601 I548V probably benign Het
Gabrb2 G A 11: 42,593,931 A272T probably damaging Het
Hcn1 C T 13: 117,975,462 P654L unknown Het
Hk1 C A 10: 62,286,570 G477C probably damaging Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Kiss1r A G 10: 79,919,425 probably null Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Loxl4 G T 19: 42,606,635 N200K probably damaging Het
Lrba T C 3: 86,285,091 V104A probably benign Het
Lyst T A 13: 13,634,900 V385D probably benign Het
Lyst T A 13: 13,637,708 C902S probably damaging Het
Mrpl28 T C 17: 26,126,287 F227S probably benign Het
Mtmr3 A T 11: 4,498,896 V289E possibly damaging Het
Ndst3 A G 3: 123,672,083 V80A probably damaging Het
Nid2 C T 14: 19,779,681 A680V possibly damaging Het
Nudcd1 T C 15: 44,405,830 N145D probably benign Het
Nup210 A T 6: 91,054,451 I812N probably damaging Het
Olfr1008 A G 2: 85,689,911 S161G possibly damaging Het
Olfr130 C T 17: 38,067,971 H267Y probably benign Het
Olfr1390 A T 11: 49,340,930 T133S probably damaging Het
Olfr1468-ps1 C A 19: 13,374,972 N3K probably damaging Het
Olfr251 T A 9: 38,378,433 M184K probably damaging Het
Olfr319 A T 11: 58,701,669 probably benign Het
Olfr503 A G 7: 108,545,245 K238R probably damaging Het
Pcdhb6 A C 18: 37,336,276 Q750P possibly damaging Het
Plppr4 T C 3: 117,360,034 Y72C probably damaging Het
Rasgrf2 G T 13: 92,022,592 probably benign Het
Sbk2 A G 7: 4,958,906 I127T probably damaging Het
Smchd1 A C 17: 71,415,044 S817A probably benign Het
Speer4b A T 5: 27,500,125 N83K probably damaging Het
Strc A T 2: 121,370,726 L1296Q probably damaging Het
Svs1 T C 6: 48,988,612 V518A possibly damaging Het
Thap11 C A 8: 105,855,583 R75S possibly damaging Het
Unc13a A C 8: 71,658,763 L268R possibly damaging Het
Zfp39 A T 11: 58,890,443 C498S unknown Het
Zfp507 T C 7: 35,795,553 T22A possibly damaging Het
Zfp85 T C 13: 67,749,593 Y120C probably benign Het
Zfp882 G A 8: 71,913,249 probably null Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88270269 missense probably benign 0.04
IGL03099:Hjurp APN 1 88266289 missense probably benign 0.09
IGL03097:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88266280 utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266046 missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266561 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266616 missense probably benign 0.04
PIT4378001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R0053:Hjurp UTSW 1 88277215 splice site probably benign
R0371:Hjurp UTSW 1 88277368 splice site probably benign
R0442:Hjurp UTSW 1 88266524 nonsense probably null
R0762:Hjurp UTSW 1 88277215 splice site probably benign
R0928:Hjurp UTSW 1 88266524 nonsense probably null
R1333:Hjurp UTSW 1 88266046 missense probably damaging 0.98
R1342:Hjurp UTSW 1 88277368 splice site probably benign
R1364:Hjurp UTSW 1 88266525 frame shift probably null
R1496:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88266121 missense probably benign 0.03
R1905:Hjurp UTSW 1 88266616 missense probably benign 0.04
R1965:Hjurp UTSW 1 88266524 nonsense probably null
R1992:Hjurp UTSW 1 88266524 nonsense probably null
R2002:Hjurp UTSW 1 88266524 nonsense probably null
R2023:Hjurp UTSW 1 88266524 nonsense probably null
R2024:Hjurp UTSW 1 88266524 nonsense probably null
R2332:Hjurp UTSW 1 88277215 splice site probably benign
R2420:Hjurp UTSW 1 88266524 nonsense probably null
R2422:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R2869:Hjurp UTSW 1 88266524 nonsense probably null
R2870:Hjurp UTSW 1 88266524 nonsense probably null
R2871:Hjurp UTSW 1 88266524 nonsense probably null
R2872:Hjurp UTSW 1 88266524 nonsense probably null
R3019:Hjurp UTSW 1 88266524 nonsense probably null
R3021:Hjurp UTSW 1 88266524 nonsense probably null
R3150:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R3411:Hjurp UTSW 1 88266524 nonsense probably null
R3552:Hjurp UTSW 1 88266524 nonsense probably null
R3704:Hjurp UTSW 1 88277215 splice site probably benign
R3730:Hjurp UTSW 1 88266524 nonsense probably null
R3733:Hjurp UTSW 1 88266524 nonsense probably null
R3764:Hjurp UTSW 1 88266524 nonsense probably null
R3799:Hjurp UTSW 1 88277215 splice site probably benign
R3819:Hjurp UTSW 1 88277215 splice site probably benign
R3857:Hjurp UTSW 1 88266524 nonsense probably null
R3930:Hjurp UTSW 1 88266524 nonsense probably null
R3952:Hjurp UTSW 1 88277215 splice site probably benign
R4090:Hjurp UTSW 1 88277215 splice site probably benign
R4159:Hjurp UTSW 1 88277215 splice site probably benign
R4207:Hjurp UTSW 1 88277215 splice site probably benign
R4322:Hjurp UTSW 1 88277215 splice site probably benign
R4391:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4392:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4397:Hjurp UTSW 1 88266524 nonsense probably null
R4700:Hjurp UTSW 1 88266524 nonsense probably null
R4808:Hjurp UTSW 1 88277215 splice site probably benign
R4900:Hjurp UTSW 1 88266524 nonsense probably null
R4901:Hjurp UTSW 1 88266524 nonsense probably null
R5023:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88266524 nonsense probably null
R5123:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88266524 nonsense probably null
R5300:Hjurp UTSW 1 88266524 nonsense probably null
R5318:Hjurp UTSW 1 88266524 nonsense probably null
R5370:Hjurp UTSW 1 88266524 nonsense probably null
R5410:Hjurp UTSW 1 88266524 nonsense probably null
R5445:Hjurp UTSW 1 88266316 missense probably benign 0.43
R5457:Hjurp UTSW 1 88266525 frame shift probably null
R5497:Hjurp UTSW 1 88266320 missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88266524 nonsense probably null
R5561:Hjurp UTSW 1 88266524 nonsense probably null
R5615:Hjurp UTSW 1 88266524 nonsense probably null
R5661:Hjurp UTSW 1 88277215 splice site probably benign
R5722:Hjurp UTSW 1 88266524 nonsense probably null
R6087:Hjurp UTSW 1 88266524 nonsense probably null
R6089:Hjurp UTSW 1 88266524 nonsense probably null
R6090:Hjurp UTSW 1 88266524 nonsense probably null
R6125:Hjurp UTSW 1 88266524 nonsense probably null
R6175:Hjurp UTSW 1 88266524 nonsense probably null
R6362:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88266524 nonsense probably null
R7016:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7016:Hjurp UTSW 1 88266278 utr 3 prime probably benign
V5622:Hjurp UTSW 1 88277525 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGGAGCTCCTTCCAAGC -3'
(R):5'- CCAGTCCTTTGAGGTTGATGAC -3'

Sequencing Primer
(F):5'- CCAAGCTGGACTGGATTTATGGAC -3'
(R):5'- CCTTTGCAATGTGACAATCAGCG -3'
Posted On2019-05-13