Incidental Mutation 'R7046:Cyp51'
ID547304
Institutional Source Beutler Lab
Gene Symbol Cyp51
Ensembl Gene ENSMUSG00000001467
Gene Namecytochrome P450, family 51
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7046 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location4081145-4104746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4100188 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 178 (E178D)
Ref Sequence ENSEMBL: ENSMUSP00000001507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001507]
Predicted Effect probably damaging
Transcript: ENSMUST00000001507
AA Change: E178D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001507
Gene: ENSMUSG00000001467
AA Change: E178D

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:p450 61 496 1.9e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein participates in the synthesis of cholesterol by catalyzing the removal of the 14alpha-methyl group from lanosterol. Homologous genes are found in all three eukaryotic phyla, fungi, plants, and animals, suggesting that this is one of the oldest cytochrome P450 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit skeletal and craniofacial abnormalities and die at late midgestation due to heart failure resulting from cardiac hypoplasia, ventricle septum, epicardial and vasculogenesis defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,122,940 Y805C probably damaging Het
Cabp7 T A 11: 4,738,886 I195F probably damaging Het
Camsap1 T C 2: 25,945,189 N317S probably damaging Het
Ccdc127 T G 13: 74,352,875 L4V probably damaging Het
Ccdc7a T C 8: 129,047,619 E145G probably damaging Het
Cdh10 T A 15: 19,013,201 V629D probably damaging Het
Cdh23 A C 10: 60,378,751 L1497R probably damaging Het
Chsy3 A G 18: 59,409,803 K671R probably benign Het
Clca4b T C 3: 144,915,606 Y569C probably damaging Het
Cnga1 T C 5: 72,629,353 probably benign Het
Defa30 T A 8: 21,135,455 N78K probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnah14 G T 1: 181,623,003 C727F probably benign Het
Egf A T 3: 129,754,958 W3R unknown Het
Egfem1 G A 3: 29,082,215 probably null Het
Epb41l1 G T 2: 156,526,892 V682L possibly damaging Het
Etv1 A G 12: 38,784,370 probably null Het
Faap100 A G 11: 120,377,374 F191S possibly damaging Het
Fam208a A T 14: 27,472,435 L1197F probably damaging Het
Fmo1 T A 1: 162,839,694 D184V possibly damaging Het
Ghrl A G 6: 113,719,383 L16P probably damaging Het
Gria4 T A 9: 4,420,278 L861F probably damaging Het
Gsr T A 8: 33,695,062 M428K probably damaging Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Kbtbd12 A G 6: 88,618,515 M111T possibly damaging Het
Krtap21-1 G T 16: 89,403,735 Y6* probably null Het
Lin9 A G 1: 180,667,370 D219G probably damaging Het
Lrrc38 A G 4: 143,350,169 M1V probably null Het
Macc1 T G 12: 119,447,038 F514V probably benign Het
Madcam1 C T 10: 79,668,305 R242C probably benign Het
Mfhas1 T C 8: 35,664,790 S1037P probably benign Het
Micall2 C T 5: 139,708,944 probably benign Het
Mtr C A 13: 12,190,209 A1122S possibly damaging Het
Muc6 T A 7: 141,640,189 probably benign Het
Myh15 T A 16: 49,109,299 C529* probably null Het
Napsa T C 7: 44,585,085 V247A probably damaging Het
Nr2c2 A G 6: 92,158,357 T309A probably damaging Het
Olfr133 A T 17: 38,148,800 M71L probably benign Het
Olfr357 T A 2: 36,997,161 V117E probably benign Het
Olfr385 A T 11: 73,589,732 I2K probably benign Het
Osgepl1 A T 1: 53,321,551 I384F possibly damaging Het
Otud4 C T 8: 79,651,042 L111F possibly damaging Het
Pds5b A G 5: 150,749,920 Y481C probably damaging Het
Pdzrn4 T A 15: 92,770,422 Y818* probably null Het
Pin1rt1 T C 2: 104,714,422 S122G probably benign Het
Pkdcc A T 17: 83,224,258 Y487F probably damaging Het
Plxna4 C T 6: 32,516,505 C392Y probably damaging Het
Psd4 T G 2: 24,394,973 M283R probably benign Het
Ralgds G T 2: 28,540,729 G68W probably damaging Het
Rmdn2 T A 17: 79,621,379 I20N probably damaging Het
Sestd1 A G 2: 77,192,566 V486A probably benign Het
Svs1 T A 6: 48,987,578 D173E probably benign Het
Tango6 A G 8: 106,807,116 H958R possibly damaging Het
Taok3 C T 5: 117,273,706 R857C probably damaging Het
Theg G T 10: 79,586,962 D35E probably benign Het
Trio T C 15: 27,832,051 E1245G probably damaging Het
Usp19 C T 9: 108,497,135 H763Y possibly damaging Het
Vmn1r185 A G 7: 26,611,226 S285P probably damaging Het
Vmn1r45 T G 6: 89,933,556 Y144S probably benign Het
Vwa3b G A 1: 37,173,878 E152K probably benign Het
Wdr61 T A 9: 54,719,255 D275V probably damaging Het
Xrcc5 G A 1: 72,394,716 M731I probably benign Het
Zfp619 G A 7: 39,537,363 S939N possibly damaging Het
Zfp874a C A 13: 67,442,299 C422F probably damaging Het
Zfp948 A G 17: 21,588,457 D637G possibly damaging Het
Other mutations in Cyp51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Cyp51 APN 5 4083247 missense probably damaging 1.00
IGL02047:Cyp51 APN 5 4099244 missense possibly damaging 0.86
IGL02191:Cyp51 APN 5 4100147 missense probably benign 0.05
IGL02492:Cyp51 APN 5 4104304 missense probably benign 0.01
IGL03209:Cyp51 APN 5 4104195 missense probably damaging 1.00
PIT4515001:Cyp51 UTSW 5 4099122 critical splice donor site probably null
PIT4520001:Cyp51 UTSW 5 4101200 missense probably damaging 1.00
R0535:Cyp51 UTSW 5 4099202 missense probably benign 0.00
R2048:Cyp51 UTSW 5 4086636 splice site probably benign
R2165:Cyp51 UTSW 5 4086594 missense probably damaging 1.00
R2851:Cyp51 UTSW 5 4099183 missense probably damaging 1.00
R3975:Cyp51 UTSW 5 4091877 missense probably damaging 0.97
R4799:Cyp51 UTSW 5 4083256 missense probably damaging 1.00
R5699:Cyp51 UTSW 5 4101213 missense probably damaging 1.00
R6163:Cyp51 UTSW 5 4100199 missense probably damaging 1.00
R6484:Cyp51 UTSW 5 4086627 missense probably benign 0.07
R7155:Cyp51 UTSW 5 4087846 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGGCCATTACCACTGCACAG -3'
(R):5'- GCCTGGATGCCATATATGCTTAGTTC -3'

Sequencing Primer
(F):5'- TTACCACTGCACAGTAGTCAG -3'
(R):5'- ATTGTTTCCTCTGTTATGCAGTAAG -3'
Posted On2019-05-13