Incidental Mutation 'R7046:Ghrl'
ID547313
Institutional Source Beutler Lab
Gene Symbol Ghrl
Ensembl Gene ENSMUSG00000064177
Gene Nameghrelin
SynonymsMTLRPAP, Ghr, 2210006E23Rik, m46, MTLRP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7046 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location113716119-113719880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113719383 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 16 (L16P)
Ref Sequence ENSEMBL: ENSMUSP00000145096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064993] [ENSMUST00000203363] [ENSMUST00000203588] [ENSMUST00000203770] [ENSMUST00000204163] [ENSMUST00000204533]
Predicted Effect probably damaging
Transcript: ENSMUST00000064993
AA Change: L16P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069567
Gene: ENSMUSG00000064177
AA Change: L16P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Motilin_ghrelin 24 51 2.7e-15 PFAM
Pfam:Motilin_assoc 57 115 1.1e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203363
AA Change: L16P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145366
Gene: ENSMUSG00000064177
AA Change: L16P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Motilin_ghrelin 24 51 1.4e-15 PFAM
low complexity region 66 73 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203588
AA Change: L16P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145514
Gene: ENSMUSG00000064177
AA Change: L16P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Motilin_assoc 29 76 1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203770
AA Change: L16P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145281
Gene: ENSMUSG00000064177
AA Change: L16P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Motilin_ghrelin 24 51 2.7e-15 PFAM
Pfam:Motilin_assoc 57 115 1.1e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204163
AA Change: L16P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145096
Gene: ENSMUSG00000064177
AA Change: L16P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Motilin_ghrelin 24 50 4e-14 PFAM
Pfam:Motilin_assoc 56 114 1.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204533
SMART Domains Protein: ENSMUSP00000145046
Gene: ENSMUSG00000064177

DomainStartEndE-ValueType
Pfam:Motilin_assoc 3 52 2.9e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene encodes a preproprotein that undergoes proteolytic processing to yield two bioactive peptides, ghrelin and obestatin. The hormone ghrelin plays a role in enhancing appetite and has numerous other biological functions that include stimulating the secretion of growth hormone (somatotropin) from the anterior pituitary gland. Obestatin is thought to be a hormone that functions in decreasing appetite. Mice lacking the encoded protein develop normally and exhibit no gross anatomical abnormalities. This gene encodes distinct isoforms, some or all of which may undergo similar proteolytic processing. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for most disruptions in this gene display no phenotypic abnormalities on a regular diet and increased utilization of fat as an energy substrate on a high fat diet. Mice homozygous for one allele display age-dependent changes in stimulated food intake and metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,122,940 Y805C probably damaging Het
Cabp7 T A 11: 4,738,886 I195F probably damaging Het
Camsap1 T C 2: 25,945,189 N317S probably damaging Het
Ccdc127 T G 13: 74,352,875 L4V probably damaging Het
Ccdc7a T C 8: 129,047,619 E145G probably damaging Het
Cdh10 T A 15: 19,013,201 V629D probably damaging Het
Cdh23 A C 10: 60,378,751 L1497R probably damaging Het
Chsy3 A G 18: 59,409,803 K671R probably benign Het
Clca4b T C 3: 144,915,606 Y569C probably damaging Het
Cnga1 T C 5: 72,629,353 probably benign Het
Cyp51 T A 5: 4,100,188 E178D probably damaging Het
Defa30 T A 8: 21,135,455 N78K probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnah14 G T 1: 181,623,003 C727F probably benign Het
Egf A T 3: 129,754,958 W3R unknown Het
Egfem1 G A 3: 29,082,215 probably null Het
Epb41l1 G T 2: 156,526,892 V682L possibly damaging Het
Etv1 A G 12: 38,784,370 probably null Het
Faap100 A G 11: 120,377,374 F191S possibly damaging Het
Fam208a A T 14: 27,472,435 L1197F probably damaging Het
Fmo1 T A 1: 162,839,694 D184V possibly damaging Het
Gria4 T A 9: 4,420,278 L861F probably damaging Het
Gsr T A 8: 33,695,062 M428K probably damaging Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Kbtbd12 A G 6: 88,618,515 M111T possibly damaging Het
Krtap21-1 G T 16: 89,403,735 Y6* probably null Het
Lin9 A G 1: 180,667,370 D219G probably damaging Het
Lrrc38 A G 4: 143,350,169 M1V probably null Het
Macc1 T G 12: 119,447,038 F514V probably benign Het
Madcam1 C T 10: 79,668,305 R242C probably benign Het
Mfhas1 T C 8: 35,664,790 S1037P probably benign Het
Micall2 C T 5: 139,708,944 probably benign Het
Mtr C A 13: 12,190,209 A1122S possibly damaging Het
Muc6 T A 7: 141,640,189 probably benign Het
Myh15 T A 16: 49,109,299 C529* probably null Het
Napsa T C 7: 44,585,085 V247A probably damaging Het
Nr2c2 A G 6: 92,158,357 T309A probably damaging Het
Olfr133 A T 17: 38,148,800 M71L probably benign Het
Olfr357 T A 2: 36,997,161 V117E probably benign Het
Olfr385 A T 11: 73,589,732 I2K probably benign Het
Osgepl1 A T 1: 53,321,551 I384F possibly damaging Het
Otud4 C T 8: 79,651,042 L111F possibly damaging Het
Pds5b A G 5: 150,749,920 Y481C probably damaging Het
Pdzrn4 T A 15: 92,770,422 Y818* probably null Het
Pin1rt1 T C 2: 104,714,422 S122G probably benign Het
Pkdcc A T 17: 83,224,258 Y487F probably damaging Het
Plxna4 C T 6: 32,516,505 C392Y probably damaging Het
Psd4 T G 2: 24,394,973 M283R probably benign Het
Ralgds G T 2: 28,540,729 G68W probably damaging Het
Rmdn2 T A 17: 79,621,379 I20N probably damaging Het
Sestd1 A G 2: 77,192,566 V486A probably benign Het
Svs1 T A 6: 48,987,578 D173E probably benign Het
Tango6 A G 8: 106,807,116 H958R possibly damaging Het
Taok3 C T 5: 117,273,706 R857C probably damaging Het
Theg G T 10: 79,586,962 D35E probably benign Het
Trio T C 15: 27,832,051 E1245G probably damaging Het
Usp19 C T 9: 108,497,135 H763Y possibly damaging Het
Vmn1r185 A G 7: 26,611,226 S285P probably damaging Het
Vmn1r45 T G 6: 89,933,556 Y144S probably benign Het
Vwa3b G A 1: 37,173,878 E152K probably benign Het
Wdr61 T A 9: 54,719,255 D275V probably damaging Het
Xrcc5 G A 1: 72,394,716 M731I probably benign Het
Zfp619 G A 7: 39,537,363 S939N possibly damaging Het
Zfp874a C A 13: 67,442,299 C422F probably damaging Het
Zfp948 A G 17: 21,588,457 D637G possibly damaging Het
Other mutations in Ghrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0128:Ghrl UTSW 6 113717168 splice site probably benign
R0391:Ghrl UTSW 6 113719338 missense probably damaging 0.98
R4925:Ghrl UTSW 6 113716257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGAACATGCTGGTGCCTGG -3'
(R):5'- AAGAGAGCCTTGCTTCGTCC -3'

Sequencing Primer
(F):5'- AGCCTTCCAGAGCTCGTG -3'
(R):5'- GTCCAGCAGTCCTTACTTCTAGAAG -3'
Posted On2019-05-13