Incidental Mutation 'R7046:Pdzrn4'
ID547341
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene NamePDZ domain containing RING finger 4
Synonyms1110017D07Rik, LNX4, SAMCAP3L
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R7046 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location92396881-92771819 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 92770422 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 818 (Y818*)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]
Predicted Effect probably null
Transcript: ENSMUST00000035399
AA Change: Y579*
SMART Domains Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: Y579*

DomainStartEndE-ValueType
Blast:PDZ 1 56 4e-24 BLAST
SCOP:d1qaua_ 20 61 1e-3 SMART
PDB:1UHP|A 21 64 9e-12 PDB
PDZ 154 229 3.01e-18 SMART
low complexity region 240 259 N/A INTRINSIC
low complexity region 267 278 N/A INTRINSIC
coiled coil region 394 430 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169942
AA Change: Y818*
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: Y818*

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,122,940 Y805C probably damaging Het
Cabp7 T A 11: 4,738,886 I195F probably damaging Het
Camsap1 T C 2: 25,945,189 N317S probably damaging Het
Ccdc127 T G 13: 74,352,875 L4V probably damaging Het
Ccdc7a T C 8: 129,047,619 E145G probably damaging Het
Cdh10 T A 15: 19,013,201 V629D probably damaging Het
Cdh23 A C 10: 60,378,751 L1497R probably damaging Het
Chsy3 A G 18: 59,409,803 K671R probably benign Het
Clca4b T C 3: 144,915,606 Y569C probably damaging Het
Cnga1 T C 5: 72,629,353 probably benign Het
Cyp51 T A 5: 4,100,188 E178D probably damaging Het
Defa30 T A 8: 21,135,455 N78K probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnah14 G T 1: 181,623,003 C727F probably benign Het
Egf A T 3: 129,754,958 W3R unknown Het
Egfem1 G A 3: 29,082,215 probably null Het
Epb41l1 G T 2: 156,526,892 V682L possibly damaging Het
Etv1 A G 12: 38,784,370 probably null Het
Faap100 A G 11: 120,377,374 F191S possibly damaging Het
Fam208a A T 14: 27,472,435 L1197F probably damaging Het
Fmo1 T A 1: 162,839,694 D184V possibly damaging Het
Ghrl A G 6: 113,719,383 L16P probably damaging Het
Gria4 T A 9: 4,420,278 L861F probably damaging Het
Gsr T A 8: 33,695,062 M428K probably damaging Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Kbtbd12 A G 6: 88,618,515 M111T possibly damaging Het
Krtap21-1 G T 16: 89,403,735 Y6* probably null Het
Lin9 A G 1: 180,667,370 D219G probably damaging Het
Lrrc38 A G 4: 143,350,169 M1V probably null Het
Macc1 T G 12: 119,447,038 F514V probably benign Het
Madcam1 C T 10: 79,668,305 R242C probably benign Het
Mfhas1 T C 8: 35,664,790 S1037P probably benign Het
Micall2 C T 5: 139,708,944 probably benign Het
Mtr C A 13: 12,190,209 A1122S possibly damaging Het
Muc6 T A 7: 141,640,189 probably benign Het
Myh15 T A 16: 49,109,299 C529* probably null Het
Napsa T C 7: 44,585,085 V247A probably damaging Het
Nr2c2 A G 6: 92,158,357 T309A probably damaging Het
Olfr133 A T 17: 38,148,800 M71L probably benign Het
Olfr357 T A 2: 36,997,161 V117E probably benign Het
Olfr385 A T 11: 73,589,732 I2K probably benign Het
Osgepl1 A T 1: 53,321,551 I384F possibly damaging Het
Otud4 C T 8: 79,651,042 L111F possibly damaging Het
Pds5b A G 5: 150,749,920 Y481C probably damaging Het
Pin1rt1 T C 2: 104,714,422 S122G probably benign Het
Pkdcc A T 17: 83,224,258 Y487F probably damaging Het
Plxna4 C T 6: 32,516,505 C392Y probably damaging Het
Psd4 T G 2: 24,394,973 M283R probably benign Het
Ralgds G T 2: 28,540,729 G68W probably damaging Het
Rmdn2 T A 17: 79,621,379 I20N probably damaging Het
Sestd1 A G 2: 77,192,566 V486A probably benign Het
Svs1 T A 6: 48,987,578 D173E probably benign Het
Tango6 A G 8: 106,807,116 H958R possibly damaging Het
Taok3 C T 5: 117,273,706 R857C probably damaging Het
Theg G T 10: 79,586,962 D35E probably benign Het
Trio T C 15: 27,832,051 E1245G probably damaging Het
Usp19 C T 9: 108,497,135 H763Y possibly damaging Het
Vmn1r185 A G 7: 26,611,226 S285P probably damaging Het
Vmn1r45 T G 6: 89,933,556 Y144S probably benign Het
Vwa3b G A 1: 37,173,878 E152K probably benign Het
Wdr61 T A 9: 54,719,255 D275V probably damaging Het
Xrcc5 G A 1: 72,394,716 M731I probably benign Het
Zfp619 G A 7: 39,537,363 S939N possibly damaging Het
Zfp874a C A 13: 67,442,299 C422F probably damaging Het
Zfp948 A G 17: 21,588,457 D637G possibly damaging Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92746278 missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92401926 splice site probably null
IGL02103:Pdzrn4 APN 15 92769887 missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92770696 missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92769850 missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92770391 missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92769881 missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92770319 missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92757657 missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92757711 missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92770271 missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92771013 makesense probably null
R1466:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92677712 missense probably benign
R1503:Pdzrn4 UTSW 15 92399804 missense probably damaging 0.99
R1561:Pdzrn4 UTSW 15 92677637 missense possibly damaging 0.84
R1584:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92401974 missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92746309 splice site probably null
R2061:Pdzrn4 UTSW 15 92770160 missense probably damaging 0.99
R3010:Pdzrn4 UTSW 15 92769811 missense probably benign 0.32
R4016:Pdzrn4 UTSW 15 92399749 missense probably benign
R4032:Pdzrn4 UTSW 15 92769533 missense probably damaging 1.00
R4110:Pdzrn4 UTSW 15 92770864 missense probably benign 0.26
R4180:Pdzrn4 UTSW 15 92402017 missense possibly damaging 0.93
R4539:Pdzrn4 UTSW 15 92770589 missense probably damaging 1.00
R4617:Pdzrn4 UTSW 15 92769842 missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92770252 nonsense probably null
R4900:Pdzrn4 UTSW 15 92770757 missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92677621 missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92770925 missense probably damaging 1.00
R5772:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92397374 missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6391:Pdzrn4 UTSW 15 92680537 missense probably damaging 0.99
R6613:Pdzrn4 UTSW 15 92677574 missense probably damaging 0.99
R7096:Pdzrn4 UTSW 15 92397503 missense probably benign 0.00
R7451:Pdzrn4 UTSW 15 92770067 missense possibly damaging 0.68
X0018:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92677709 missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92680512 missense possibly damaging 0.92
X0065:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCATGATGACAGCCCATC -3'
(R):5'- CACTGGCCTCTTGGTGATGTAC -3'

Sequencing Primer
(F):5'- TGATGACAGCCCATCAGTCC -3'
(R):5'- TGATGTACCGGGTCCCATCAC -3'
Posted On2019-05-13