Incidental Mutation 'R7047:Sh2d3c'
ID547355
Institutional Source Beutler Lab
Gene Symbol Sh2d3c
Ensembl Gene ENSMUSG00000059013
Gene NameSH2 domain containing 3C
SynonymsChat, Cas/HEF1-associated signal transducer, Nsp3, Shep1, SH2-containing Eph receptor-binding protein 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7047 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32721055-32755512 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 32721160 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000073866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074248]
Predicted Effect probably null
Transcript: ENSMUST00000074248
AA Change: M1T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000073866
Gene: ENSMUSG00000059013
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
low complexity region 22 43 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
low complexity region 190 207 N/A INTRINSIC
SH2 213 301 7.8e-21 SMART
low complexity region 333 348 N/A INTRINSIC
low complexity region 400 415 N/A INTRINSIC
low complexity region 422 436 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
RasGEF 576 849 8.18e-10 SMART
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein and member of a cytoplasmic protein family involved in cell migration. The encoded protein contains a putative Src homology 2 (SH2) domain and guanine nucleotide exchange factor-like domain which allows this signaling protein to form a complex with scaffolding protein Crk-associated substrate. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with absence of gastric milk. Surviving mice exhibit abnormal olfactory bulb innervation, fewer gonadotrophin positive cells in the hypothalamus, and decreased testes size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,660,174 I1278N possibly damaging Het
Adcy5 T A 16: 35,267,215 L482Q probably damaging Het
Adora2a A G 10: 75,326,311 I95V probably damaging Het
Anapc1 A C 2: 128,615,430 C1887G probably damaging Het
Arfgef2 T A 2: 166,851,945 probably null Het
Capn11 G T 17: 45,638,696 S448* probably null Het
Capn7 C T 14: 31,336,685 probably benign Het
Cep55 T A 19: 38,060,091 V65D possibly damaging Het
Col5a1 A G 2: 27,928,084 K107R unknown Het
Dbh T A 2: 27,165,610 I32N possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dzip3 A T 16: 48,982,126 N13K probably benign Het
Emilin1 A G 5: 30,917,078 N221S probably benign Het
Ext2 A G 2: 93,739,657 F470L probably damaging Het
Fam71f1 T A 6: 29,323,810 L178H probably damaging Het
Filip1 T A 9: 79,853,634 Q206L probably damaging Het
Gpr63 G T 4: 25,007,320 A15S probably benign Het
Grhl3 T C 4: 135,549,240 probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Ift172 G T 5: 31,275,894 Y193* probably null Het
Ints1 A C 5: 139,758,471 L1512* probably null Het
Kat2b A G 17: 53,663,569 Q661R probably benign Het
Kat6a A G 8: 22,938,538 N1303S possibly damaging Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Maml2 T C 9: 13,620,881 probably benign Het
Mixl1 A G 1: 180,696,618 probably null Het
Mocs1 T C 17: 49,452,859 probably null Het
Ms4a15 T G 19: 10,984,872 N36T probably damaging Het
Msr1 G A 8: 39,642,616 T2I possibly damaging Het
Nlgn1 A C 3: 25,436,035 Y509* probably null Het
Nsmce1 C A 7: 125,491,434 G4C probably benign Het
Olfr1218 A T 2: 89,055,146 F93L probably damaging Het
Olfr621-ps1 A G 7: 103,629,711 V83A probably damaging Het
Pan3 G A 5: 147,546,365 G452D probably damaging Het
Pcyox1 G T 6: 86,388,909 P441H probably damaging Het
Phf12 T C 11: 78,013,273 V273A probably damaging Het
Plcd4 A G 1: 74,551,989 E181G possibly damaging Het
Ptgfr A T 3: 151,835,541 I110N possibly damaging Het
Rab40c A C 17: 25,919,484 V8G probably damaging Het
Rasal3 T A 17: 32,396,484 Y460F probably damaging Het
Rhbdf2 A G 11: 116,603,651 probably null Het
Ryr2 T A 13: 11,824,400 N496Y possibly damaging Het
Sacs A T 14: 61,213,002 I4166F probably damaging Het
Smarca2 C T 19: 26,669,155 S651L possibly damaging Het
Sned1 A T 1: 93,285,818 R1204S possibly damaging Het
Spata31d1b T C 13: 59,712,435 Y41H probably damaging Het
Stab2 C T 10: 86,858,152 C2075Y probably damaging Het
Tcte1 A T 17: 45,533,368 Q90L possibly damaging Het
Tll2 C T 19: 41,086,240 G945S probably damaging Het
Tmbim7 A T 5: 3,670,112 T116S probably benign Het
Tnfrsf19 A T 14: 61,005,218 C72* probably null Het
Usp17le T A 7: 104,768,433 T501S probably benign Het
Wnt5b T A 6: 119,448,256 probably benign Het
Other mutations in Sh2d3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Sh2d3c APN 2 32725084 missense probably benign 0.00
IGL02326:Sh2d3c APN 2 32749151 critical splice acceptor site probably null
IGL03325:Sh2d3c APN 2 32725258 missense probably benign 0.00
R0008:Sh2d3c UTSW 2 32753021 missense probably damaging 1.00
R0564:Sh2d3c UTSW 2 32753052 missense probably damaging 0.99
R0619:Sh2d3c UTSW 2 32753025 missense probably damaging 1.00
R1138:Sh2d3c UTSW 2 32749405 missense probably benign 0.00
R1984:Sh2d3c UTSW 2 32749244 nonsense probably null
R3808:Sh2d3c UTSW 2 32746096 missense probably damaging 1.00
R4399:Sh2d3c UTSW 2 32746160 missense probably damaging 0.97
R4556:Sh2d3c UTSW 2 32753009 missense possibly damaging 0.81
R4840:Sh2d3c UTSW 2 32721160 start codon destroyed probably null 0.02
R5027:Sh2d3c UTSW 2 32744802 missense possibly damaging 0.95
R5367:Sh2d3c UTSW 2 32745902 missense probably damaging 1.00
R6754:Sh2d3c UTSW 2 32754530 missense probably damaging 1.00
R6916:Sh2d3c UTSW 2 32752653 nonsense probably null
R7029:Sh2d3c UTSW 2 32754569 makesense probably null
Predicted Primers PCR Primer
(F):5'- CCTTCTAGGTCCCAAGGGTTTG -3'
(R):5'- CCACAGCATGTGCAGATAGC -3'

Sequencing Primer
(F):5'- CCCAAGGGTTTGCGGTG -3'
(R):5'- GATAGCAACACCAACACCGAGG -3'
Posted On2019-05-13