Incidental Mutation 'R7047:Kat6a'
ID547374
Institutional Source Beutler Lab
Gene Symbol Kat6a
Ensembl Gene ENSMUSG00000031540
Gene NameK(lysine) acetyltransferase 6A
SynonymsZfp220, MOZ, 9930021N24Rik, Myst3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7047 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location22859535-22943259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22938538 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1303 (N1303S)
Ref Sequence ENSEMBL: ENSMUSP00000106324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044331] [ENSMUST00000110696]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044331
AA Change: N1303S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038181
Gene: ENSMUSG00000031540
AA Change: N1303S

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 561 748 5.9e-92 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110696
AA Change: N1303S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106324
Gene: ENSMUSG00000031540
AA Change: N1303S

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 564 742 2.9e-85 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MOZ, YBFR2, SAS2, TIP60 family of histone acetyltransferases. The protein is composed of a nuclear localization domain, a double C2H2 zinc finger domain that binds to acetylated histone tails, a histone acetyl-transferase domain, a glutamate/aspartate-rich region, and a serine- and methionine-rich transactivation domain. It is part of a complex that acetylates lysine-9 residues in histone 3, and in addition, it acts as a co-activator for several transcription factors. Allelic variants of this gene are associated with autosomal dominant mental retardation-32. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display perinatal lethality, cyanosis, decreased hematopoietic progenitor cell numbers, and severely impaired spleen and thymus development, but are not anemic. Heterozygotes display strain background dependent reductions in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,660,174 I1278N possibly damaging Het
Adcy5 T A 16: 35,267,215 L482Q probably damaging Het
Adora2a A G 10: 75,326,311 I95V probably damaging Het
Anapc1 A C 2: 128,615,430 C1887G probably damaging Het
Arfgef2 T A 2: 166,851,945 probably null Het
Capn11 G T 17: 45,638,696 S448* probably null Het
Capn7 C T 14: 31,336,685 probably benign Het
Cep55 T A 19: 38,060,091 V65D possibly damaging Het
Col5a1 A G 2: 27,928,084 K107R unknown Het
Dbh T A 2: 27,165,610 I32N possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dzip3 A T 16: 48,982,126 N13K probably benign Het
Emilin1 A G 5: 30,917,078 N221S probably benign Het
Ext2 A G 2: 93,739,657 F470L probably damaging Het
Fam71f1 T A 6: 29,323,810 L178H probably damaging Het
Filip1 T A 9: 79,853,634 Q206L probably damaging Het
Gpr63 G T 4: 25,007,320 A15S probably benign Het
Grhl3 T C 4: 135,549,240 probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Ift172 G T 5: 31,275,894 Y193* probably null Het
Ints1 A C 5: 139,758,471 L1512* probably null Het
Kat2b A G 17: 53,663,569 Q661R probably benign Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Maml2 T C 9: 13,620,881 probably benign Het
Mixl1 A G 1: 180,696,618 probably null Het
Mocs1 T C 17: 49,452,859 probably null Het
Ms4a15 T G 19: 10,984,872 N36T probably damaging Het
Msr1 G A 8: 39,642,616 T2I possibly damaging Het
Nlgn1 A C 3: 25,436,035 Y509* probably null Het
Nsmce1 C A 7: 125,491,434 G4C probably benign Het
Olfr1218 A T 2: 89,055,146 F93L probably damaging Het
Olfr621-ps1 A G 7: 103,629,711 V83A probably damaging Het
Pan3 G A 5: 147,546,365 G452D probably damaging Het
Pcyox1 G T 6: 86,388,909 P441H probably damaging Het
Phf12 T C 11: 78,013,273 V273A probably damaging Het
Plcd4 A G 1: 74,551,989 E181G possibly damaging Het
Ptgfr A T 3: 151,835,541 I110N possibly damaging Het
Rab40c A C 17: 25,919,484 V8G probably damaging Het
Rasal3 T A 17: 32,396,484 Y460F probably damaging Het
Rhbdf2 A G 11: 116,603,651 probably null Het
Ryr2 T A 13: 11,824,400 N496Y possibly damaging Het
Sacs A T 14: 61,213,002 I4166F probably damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Smarca2 C T 19: 26,669,155 S651L possibly damaging Het
Sned1 A T 1: 93,285,818 R1204S possibly damaging Het
Spata31d1b T C 13: 59,712,435 Y41H probably damaging Het
Stab2 C T 10: 86,858,152 C2075Y probably damaging Het
Tcte1 A T 17: 45,533,368 Q90L possibly damaging Het
Tll2 C T 19: 41,086,240 G945S probably damaging Het
Tmbim7 A T 5: 3,670,112 T116S probably benign Het
Tnfrsf19 A T 14: 61,005,218 C72* probably null Het
Usp17le T A 7: 104,768,433 T501S probably benign Het
Wnt5b T A 6: 119,448,256 probably benign Het
Other mutations in Kat6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Kat6a APN 8 22940263 missense unknown
IGL01093:Kat6a APN 8 22939321 missense possibly damaging 0.85
IGL01364:Kat6a APN 8 22907700 missense probably damaging 1.00
IGL01868:Kat6a APN 8 22926455 missense probably damaging 1.00
IGL02477:Kat6a APN 8 22929300 missense probably damaging 1.00
IGL02792:Kat6a APN 8 22938300 missense probably damaging 0.98
IGL03243:Kat6a APN 8 22910222 missense possibly damaging 0.77
Anning UTSW 8 22932113 critical splice acceptor site probably null
lord UTSW 8 22862364 missense probably damaging 1.00
master UTSW 8 22862788 missense probably damaging 0.99
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0284:Kat6a UTSW 8 22939803 missense unknown
R0636:Kat6a UTSW 8 22939323 missense possibly damaging 0.73
R0883:Kat6a UTSW 8 22862214 missense probably damaging 1.00
R1457:Kat6a UTSW 8 22938652 missense probably benign
R1753:Kat6a UTSW 8 22935797 missense probably benign 0.09
R2059:Kat6a UTSW 8 22939305 missense possibly damaging 0.53
R2155:Kat6a UTSW 8 22935647 small deletion probably benign
R2764:Kat6a UTSW 8 22932178 missense probably damaging 1.00
R3724:Kat6a UTSW 8 22862788 missense probably damaging 0.99
R3824:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R3825:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R4370:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4371:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4457:Kat6a UTSW 8 22932113 critical splice acceptor site probably null
R4600:Kat6a UTSW 8 22939311 missense probably benign 0.18
R4792:Kat6a UTSW 8 22940576 missense unknown
R4896:Kat6a UTSW 8 22938313 missense probably benign 0.07
R5069:Kat6a UTSW 8 22903133 missense probably damaging 1.00
R5192:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5196:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5279:Kat6a UTSW 8 22939648 small deletion probably benign
R5331:Kat6a UTSW 8 22939984 missense unknown
R5480:Kat6a UTSW 8 22938307 missense possibly damaging 0.77
R5659:Kat6a UTSW 8 22938160 nonsense probably null
R5759:Kat6a UTSW 8 22938012 missense probably benign 0.04
R5787:Kat6a UTSW 8 22932647 missense probably damaging 0.99
R5892:Kat6a UTSW 8 22938289 missense probably damaging 1.00
R5923:Kat6a UTSW 8 22939479 missense probably benign 0.00
R6049:Kat6a UTSW 8 22939037 missense possibly damaging 0.53
R6223:Kat6a UTSW 8 22940426 missense unknown
R6276:Kat6a UTSW 8 22939405 missense possibly damaging 0.96
R6279:Kat6a UTSW 8 22939612 missense unknown
R6300:Kat6a UTSW 8 22939612 missense unknown
R6307:Kat6a UTSW 8 22940368 missense unknown
R6562:Kat6a UTSW 8 22911787 missense probably benign 0.04
R6807:Kat6a UTSW 8 22940368 missense unknown
R6852:Kat6a UTSW 8 22938660 missense probably benign 0.18
R6875:Kat6a UTSW 8 22932361 missense probably benign 0.02
R6895:Kat6a UTSW 8 22935783 missense possibly damaging 0.88
R6913:Kat6a UTSW 8 22903199 missense possibly damaging 0.53
R7235:Kat6a UTSW 8 22914269 missense possibly damaging 0.94
R7243:Kat6a UTSW 8 22938775 missense probably benign 0.00
R7454:Kat6a UTSW 8 22935772 missense possibly damaging 0.56
X0050:Kat6a UTSW 8 22940481 nonsense probably null
Z1088:Kat6a UTSW 8 22935501 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGATACAACCAGCAGTGAC -3'
(R):5'- GCTGGTCTTCCTCAGAATCC -3'

Sequencing Primer
(F):5'- GCAGTGACATTAGAGCCATGTCC -3'
(R):5'- AGAATCCGGTTCAGCCTCATC -3'
Posted On2019-05-13