Incidental Mutation 'R7047:Rab40c'
ID547390
Institutional Source Beutler Lab
Gene Symbol Rab40c
Ensembl Gene ENSMUSG00000025730
Gene NameRab40C, member RAS oncogene family
SynonymsRAR3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R7047 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25882114-25919727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 25919484 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 8 (V8G)
Ref Sequence ENSEMBL: ENSMUSP00000136612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026826] [ENSMUST00000164738] [ENSMUST00000164982] [ENSMUST00000166146] [ENSMUST00000167018] [ENSMUST00000167626] [ENSMUST00000179998]
Predicted Effect probably damaging
Transcript: ENSMUST00000026826
AA Change: V8G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026826
Gene: ENSMUSG00000025730
AA Change: V8G

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164738
AA Change: V8G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130093
Gene: ENSMUSG00000025730
AA Change: V8G

DomainStartEndE-ValueType
Pfam:Arf 5 110 5.2e-7 PFAM
Pfam:Miro 16 111 4.2e-12 PFAM
Pfam:Ras 16 111 2.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164982
AA Change: V8G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127868
Gene: ENSMUSG00000025730
AA Change: V8G

DomainStartEndE-ValueType
RAB 15 158 5.56e-54 SMART
SOCS 164 207 2.56e-16 SMART
SOCS_box 170 206 9.29e-6 SMART
low complexity region 219 243 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166146
AA Change: V8G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132355
Gene: ENSMUSG00000025730
AA Change: V8G

DomainStartEndE-ValueType
SCOP:d3raba_ 10 43 3e-9 SMART
Blast:RAB 15 49 1e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000167018
AA Change: V8G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131055
Gene: ENSMUSG00000025730
AA Change: V8G

DomainStartEndE-ValueType
RAB 15 177 1.88e-74 SMART
SOCS 183 226 2.56e-16 SMART
SOCS_box 189 225 9.29e-6 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167626
AA Change: V8G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127546
Gene: ENSMUSG00000025730
AA Change: V8G

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179998
AA Change: V8G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136612
Gene: ENSMUSG00000025730
AA Change: V8G

DomainStartEndE-ValueType
RAB 15 177 9.4e-77 SMART
SOCS 183 226 1.7e-18 SMART
SOCS_box 189 225 7.3e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,660,174 I1278N possibly damaging Het
Adcy5 T A 16: 35,267,215 L482Q probably damaging Het
Adora2a A G 10: 75,326,311 I95V probably damaging Het
Anapc1 A C 2: 128,615,430 C1887G probably damaging Het
Arfgef2 T A 2: 166,851,945 probably null Het
Capn11 G T 17: 45,638,696 S448* probably null Het
Capn7 C T 14: 31,336,685 probably benign Het
Cep55 T A 19: 38,060,091 V65D possibly damaging Het
Col5a1 A G 2: 27,928,084 K107R unknown Het
Dbh T A 2: 27,165,610 I32N possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dzip3 A T 16: 48,982,126 N13K probably benign Het
Emilin1 A G 5: 30,917,078 N221S probably benign Het
Ext2 A G 2: 93,739,657 F470L probably damaging Het
Fam71f1 T A 6: 29,323,810 L178H probably damaging Het
Filip1 T A 9: 79,853,634 Q206L probably damaging Het
Gpr63 G T 4: 25,007,320 A15S probably benign Het
Grhl3 T C 4: 135,549,240 probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Ift172 G T 5: 31,275,894 Y193* probably null Het
Ints1 A C 5: 139,758,471 L1512* probably null Het
Kat2b A G 17: 53,663,569 Q661R probably benign Het
Kat6a A G 8: 22,938,538 N1303S possibly damaging Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Maml2 T C 9: 13,620,881 probably benign Het
Mixl1 A G 1: 180,696,618 probably null Het
Mocs1 T C 17: 49,452,859 probably null Het
Ms4a15 T G 19: 10,984,872 N36T probably damaging Het
Msr1 G A 8: 39,642,616 T2I possibly damaging Het
Nlgn1 A C 3: 25,436,035 Y509* probably null Het
Nsmce1 C A 7: 125,491,434 G4C probably benign Het
Olfr1218 A T 2: 89,055,146 F93L probably damaging Het
Olfr621-ps1 A G 7: 103,629,711 V83A probably damaging Het
Pan3 G A 5: 147,546,365 G452D probably damaging Het
Pcyox1 G T 6: 86,388,909 P441H probably damaging Het
Phf12 T C 11: 78,013,273 V273A probably damaging Het
Plcd4 A G 1: 74,551,989 E181G possibly damaging Het
Ptgfr A T 3: 151,835,541 I110N possibly damaging Het
Rasal3 T A 17: 32,396,484 Y460F probably damaging Het
Rhbdf2 A G 11: 116,603,651 probably null Het
Ryr2 T A 13: 11,824,400 N496Y possibly damaging Het
Sacs A T 14: 61,213,002 I4166F probably damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Smarca2 C T 19: 26,669,155 S651L possibly damaging Het
Sned1 A T 1: 93,285,818 R1204S possibly damaging Het
Spata31d1b T C 13: 59,712,435 Y41H probably damaging Het
Stab2 C T 10: 86,858,152 C2075Y probably damaging Het
Tcte1 A T 17: 45,533,368 Q90L possibly damaging Het
Tll2 C T 19: 41,086,240 G945S probably damaging Het
Tmbim7 A T 5: 3,670,112 T116S probably benign Het
Tnfrsf19 A T 14: 61,005,218 C72* probably null Het
Usp17le T A 7: 104,768,433 T501S probably benign Het
Wnt5b T A 6: 119,448,256 probably benign Het
Other mutations in Rab40c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Rab40c APN 17 25885085 missense probably damaging 1.00
IGL01793:Rab40c APN 17 25884622 missense probably damaging 1.00
IGL01936:Rab40c APN 17 25884670 missense probably damaging 0.99
R0089:Rab40c UTSW 17 25885148 missense probably damaging 1.00
R0456:Rab40c UTSW 17 25884657 missense possibly damaging 0.68
R0837:Rab40c UTSW 17 25884693 missense probably damaging 1.00
R1547:Rab40c UTSW 17 25883750 missense probably damaging 1.00
R5488:Rab40c UTSW 17 25890669 missense probably damaging 0.98
R5955:Rab40c UTSW 17 25884657 missense probably damaging 0.98
X0028:Rab40c UTSW 17 25890708 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTTAGTAGCCACCAGGACC -3'
(R):5'- GGACGGGACTTCAGTGATAGAC -3'

Sequencing Primer
(F):5'- CAGAGGATACCGCAGCGAC -3'
(R):5'- CTTCAGTGATAGACAAGCATGTAGAC -3'
Posted On2019-05-13