Incidental Mutation 'R7049:Tnik'
ID547472
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene NameTRAF2 and NCK interacting kinase
SynonymsC630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7049 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location28263214-28675858 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 28661704 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1093 (K1093*)
Ref Sequence ENSEMBL: ENSMUSP00000124726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
Predicted Effect probably null
Transcript: ENSMUST00000159236
AA Change: K1119*
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: K1119*

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159308
AA Change: K1072*
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: K1072*

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159680
AA Change: K1148*
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: K1148*

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160307
AA Change: K1156*
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: K1156*

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160518
AA Change: K1127*
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: K1127*

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160934
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161964
AA Change: K1064*
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: K1064*

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162485
AA Change: K1101*
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: K1101*

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162777
AA Change: K1093*
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: K1093*

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Meta Mutation Damage Score 0.604 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik T C 6: 116,652,293 L199P probably damaging Het
Abca4 T C 3: 122,147,848 V447A probably benign Het
Adam6b A G 12: 113,490,502 D313G probably damaging Het
Adcy10 G T 1: 165,539,874 C571F probably damaging Het
Anxa1 A G 19: 20,375,271 V313A probably benign Het
Bpifb6 A T 2: 153,908,813 probably null Het
Cacna1c C A 6: 118,601,163 C1713F probably benign Het
Cep135 A G 5: 76,606,738 N354S probably benign Het
Cers2 A G 3: 95,321,654 D200G probably damaging Het
Cpne1 A G 2: 156,078,807 L133P probably damaging Het
Ddhd1 A G 14: 45,602,681 Y16H probably damaging Het
Fastkd2 T C 1: 63,731,850 F122L probably benign Het
Fastkd5 A T 2: 130,615,511 D386E probably damaging Het
Gm5134 T A 10: 75,992,458 C291S probably damaging Het
Gria2 T C 3: 80,689,327 S811G probably damaging Het
Hcn1 C T 13: 117,975,462 P654L unknown Het
Hrnr C A 3: 93,323,154 S233* probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Itgal A T 7: 127,296,401 probably benign Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Mical1 A G 10: 41,482,250 R420G possibly damaging Het
Mllt6 T A 11: 97,673,811 L481Q probably damaging Het
Mtdh T A 15: 34,131,165 N174K probably damaging Het
Nhsl1 A G 10: 18,531,638 M1507V probably damaging Het
Npm3 A T 19: 45,749,555 M1K probably null Het
Olfr380 C T 11: 73,453,604 G203R probably damaging Het
Pold1 A T 7: 44,541,371 W290R possibly damaging Het
Prss52 C T 14: 64,112,572 T216I probably damaging Het
Psme4 T C 11: 30,813,904 probably null Het
Pwwp2a T A 11: 43,706,191 F453I probably damaging Het
Rttn A G 18: 89,064,216 N1422S probably damaging Het
Scaf4 A C 16: 90,260,187 I92R unknown Het
Slc12a1 A G 2: 125,171,257 K345E probably benign Het
Slc22a28 A T 19: 8,071,905 N326K probably benign Het
Smgc A G 15: 91,860,378 E311G possibly damaging Het
Snx7 C T 3: 117,840,031 R90H possibly damaging Het
Tex101 A G 7: 24,668,258 I223T probably benign Het
Tnxb T G 17: 34,717,268 probably null Het
Trio T C 15: 27,749,799 N2272S possibly damaging Het
Tubal3 T C 13: 3,932,756 Y179H probably damaging Het
Vmn2r4 C T 3: 64,389,129 G745D probably benign Het
Vps9d1 A T 8: 123,247,143 Y300* probably null Het
Zfp646 T A 7: 127,880,027 C459S possibly damaging Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28654218 missense probably damaging 1.00
IGL00726:Tnik APN 3 28532898 missense probably damaging 1.00
IGL01022:Tnik APN 3 28625228 splice site probably null
IGL01145:Tnik APN 3 28604167 intron probably benign
IGL01664:Tnik APN 3 28638479 missense probably damaging 1.00
IGL01843:Tnik APN 3 28570858 splice site probably null
IGL02378:Tnik APN 3 28638459 nonsense probably null
IGL02448:Tnik APN 3 28621077 missense probably null 0.01
IGL02756:Tnik APN 3 28542030 missense probably damaging 1.00
IGL03332:Tnik APN 3 28666155 missense probably damaging 1.00
Usher UTSW 3 28564097 missense possibly damaging 0.61
R0135:Tnik UTSW 3 28607245 missense possibly damaging 0.67
R0418:Tnik UTSW 3 28570880 nonsense probably null
R0540:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0549:Tnik UTSW 3 28570920 missense possibly damaging 0.87
R0556:Tnik UTSW 3 28625218 missense possibly damaging 0.95
R0586:Tnik UTSW 3 28577361 splice site probably benign
R0607:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0842:Tnik UTSW 3 28594086 missense possibly damaging 0.72
R1068:Tnik UTSW 3 28532975 missense probably damaging 1.00
R1171:Tnik UTSW 3 28532940 missense probably damaging 1.00
R1597:Tnik UTSW 3 28604269 missense probably damaging 1.00
R1638:Tnik UTSW 3 28665740 missense probably damaging 0.99
R1652:Tnik UTSW 3 28604293 missense probably benign 0.22
R1996:Tnik UTSW 3 28665680 missense probably damaging 1.00
R2333:Tnik UTSW 3 28532996 missense probably damaging 1.00
R2426:Tnik UTSW 3 28646681 missense probably damaging 1.00
R2509:Tnik UTSW 3 28667915 missense probably damaging 1.00
R3774:Tnik UTSW 3 28638419 missense probably damaging 0.98
R3775:Tnik UTSW 3 28638419 missense probably damaging 0.98
R4007:Tnik UTSW 3 28604281 missense probably damaging 1.00
R4119:Tnik UTSW 3 28666175 missense probably damaging 1.00
R4209:Tnik UTSW 3 28359065 splice site probably benign
R4441:Tnik UTSW 3 28564097 missense possibly damaging 0.61
R4611:Tnik UTSW 3 28542100 critical splice donor site probably null
R4714:Tnik UTSW 3 28594077 missense possibly damaging 0.53
R4772:Tnik UTSW 3 28607210 missense probably benign 0.09
R4829:Tnik UTSW 3 28539541 intron probably benign
R4839:Tnik UTSW 3 28596075 missense possibly damaging 0.86
R4898:Tnik UTSW 3 28650086 missense probably damaging 1.00
R5029:Tnik UTSW 3 28665844 splice site probably null
R5278:Tnik UTSW 3 28650060 missense probably damaging 1.00
R5307:Tnik UTSW 3 28541972 missense probably damaging 1.00
R5330:Tnik UTSW 3 28542018 missense probably damaging 1.00
R5375:Tnik UTSW 3 28594092 missense probably benign 0.02
R5459:Tnik UTSW 3 28661741 missense probably damaging 1.00
R5708:Tnik UTSW 3 28611971 critical splice donor site probably null
R5749:Tnik UTSW 3 28594092 missense probably benign 0.02
R5751:Tnik UTSW 3 28594092 missense probably benign 0.02
R5780:Tnik UTSW 3 28594092 missense probably benign 0.02
R5837:Tnik UTSW 3 28668053 unclassified probably benign
R5969:Tnik UTSW 3 28620948 missense probably damaging 1.00
R6244:Tnik UTSW 3 28650179 missense probably damaging 1.00
R6273:Tnik UTSW 3 28577500 missense possibly damaging 0.94
R6457:Tnik UTSW 3 28539448 missense probably damaging 1.00
R6464:Tnik UTSW 3 28611970 critical splice donor site probably null
R6473:Tnik UTSW 3 28263643 start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28596086 missense possibly damaging 0.72
R7237:Tnik UTSW 3 28638419 missense probably damaging 0.98
R7267:Tnik UTSW 3 28646627 missense probably damaging 0.99
X0022:Tnik UTSW 3 28667951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCCTTATCAGAGTGAATATCC -3'
(R):5'- TGAAGTCAACAGTTCATAGACCCC -3'

Sequencing Primer
(F):5'- CCTATAGACAGGCACCTACA -3'
(R):5'- CCCCAGTGGAAGAGGACAATC -3'
Posted On2019-05-13