Incidental Mutation 'R7049:Hcn1'
ID547495
Institutional Source Beutler Lab
Gene Symbol Hcn1
Ensembl Gene ENSMUSG00000021730
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 1
SynonymsHAC2, Bcng1, C630013B14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7049 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location117602320-117987418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117975462 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 654 (P654L)
Ref Sequence ENSEMBL: ENSMUSP00000006991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006991]
PDB Structure
Tetramerization dynamics of the C-terminus underlies isoform-specific cAMP-gating in HCN channels [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000006991
AA Change: P654L
SMART Domains Protein: ENSMUSP00000006991
Gene: ENSMUSG00000021730
AA Change: P654L

DomainStartEndE-ValueType
Pfam:Ion_trans_N 87 130 8.2e-24 PFAM
Pfam:Ion_trans 131 394 2.1e-23 PFAM
low complexity region 395 406 N/A INTRINSIC
Blast:cNMP 407 439 4e-13 BLAST
cNMP 464 580 1.95e-22 SMART
low complexity region 639 655 N/A INTRINSIC
low complexity region 660 680 N/A INTRINSIC
low complexity region 720 779 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this allele display learning deficiencies but are otherwise normal. Mice homozygous for another targeted knock-out exhibit deficit in hyperpolarization-activated currents and cold allodynia following partial nerve ligation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik T C 6: 116,652,293 L199P probably damaging Het
Abca4 T C 3: 122,147,848 V447A probably benign Het
Adam6b A G 12: 113,490,502 D313G probably damaging Het
Adcy10 G T 1: 165,539,874 C571F probably damaging Het
Anxa1 A G 19: 20,375,271 V313A probably benign Het
Cacna1c C A 6: 118,601,163 C1713F probably benign Het
Cep135 A G 5: 76,606,738 N354S probably benign Het
Cers2 A G 3: 95,321,654 D200G probably damaging Het
Cpne1 A G 2: 156,078,807 L133P probably damaging Het
Ddhd1 A G 14: 45,602,681 Y16H probably damaging Het
Fastkd2 T C 1: 63,731,850 F122L probably benign Het
Fastkd5 A T 2: 130,615,511 D386E probably damaging Het
Gm5134 T A 10: 75,992,458 C291S probably damaging Het
Gria2 T C 3: 80,689,327 S811G probably damaging Het
Hrnr C A 3: 93,323,154 S233* probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Itgal A T 7: 127,296,401 probably benign Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Mical1 A G 10: 41,482,250 R420G possibly damaging Het
Mllt6 T A 11: 97,673,811 L481Q probably damaging Het
Mtdh T A 15: 34,131,165 N174K probably damaging Het
Nhsl1 A G 10: 18,531,638 M1507V probably damaging Het
Npm3 A T 19: 45,749,555 M1K probably null Het
Olfr380 C T 11: 73,453,604 G203R probably damaging Het
Pold1 A T 7: 44,541,371 W290R possibly damaging Het
Prss52 C T 14: 64,112,572 T216I probably damaging Het
Pwwp2a T A 11: 43,706,191 F453I probably damaging Het
Rttn A G 18: 89,064,216 N1422S probably damaging Het
Scaf4 A C 16: 90,260,187 I92R unknown Het
Slc12a1 A G 2: 125,171,257 K345E probably benign Het
Slc22a28 A T 19: 8,071,905 N326K probably benign Het
Smgc A G 15: 91,860,378 E311G possibly damaging Het
Snx7 C T 3: 117,840,031 R90H possibly damaging Het
Tex101 A G 7: 24,668,258 I223T probably benign Het
Tnik A T 3: 28,661,704 K1093* probably null Het
Tnxb T G 17: 34,717,268 probably null Het
Trio T C 15: 27,749,799 N2272S possibly damaging Het
Tubal3 T C 13: 3,932,756 Y179H probably damaging Het
Vmn2r4 C T 3: 64,389,129 G745D probably benign Het
Vps9d1 A T 8: 123,247,143 Y300* probably null Het
Zfp646 T A 7: 127,880,027 C459S possibly damaging Het
Other mutations in Hcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Hcn1 APN 13 117975993 missense probably damaging 1.00
IGL00340:Hcn1 APN 13 117602977 missense unknown
IGL01161:Hcn1 APN 13 117656922 missense unknown
IGL01723:Hcn1 APN 13 117976055 missense probably damaging 0.98
IGL02324:Hcn1 APN 13 117902886 missense unknown
IGL02491:Hcn1 APN 13 117810040 missense unknown
Thump UTSW 13 117873905 nonsense probably null
FR4976:Hcn1 UTSW 13 117975808 small insertion probably benign
PIT4504001:Hcn1 UTSW 13 117975875 missense possibly damaging 0.90
R0420:Hcn1 UTSW 13 117975375 missense unknown
R1546:Hcn1 UTSW 13 117975766 small insertion probably benign
R1558:Hcn1 UTSW 13 117975576 missense unknown
R1659:Hcn1 UTSW 13 117976074 missense probably damaging 0.99
R1667:Hcn1 UTSW 13 117603073 missense unknown
R1766:Hcn1 UTSW 13 117656734 missense probably benign 0.39
R1842:Hcn1 UTSW 13 117976008 missense probably damaging 0.99
R2051:Hcn1 UTSW 13 117976083 missense probably damaging 0.99
R3605:Hcn1 UTSW 13 117975252 missense unknown
R4259:Hcn1 UTSW 13 117975348 missense unknown
R4284:Hcn1 UTSW 13 117975733 small deletion probably benign
R4637:Hcn1 UTSW 13 117975713 missense unknown
R4679:Hcn1 UTSW 13 117657015 missense probably benign 0.39
R4777:Hcn1 UTSW 13 117975733 small deletion probably benign
R4839:Hcn1 UTSW 13 117925710 missense unknown
R4883:Hcn1 UTSW 13 117902895 critical splice donor site probably null
R5015:Hcn1 UTSW 13 117603020 missense unknown
R5060:Hcn1 UTSW 13 117873905 nonsense probably null
R5748:Hcn1 UTSW 13 117976055 missense probably damaging 0.99
R5823:Hcn1 UTSW 13 117602852 missense unknown
R6900:Hcn1 UTSW 13 117656827 missense probably benign 0.39
R7045:Hcn1 UTSW 13 117975462 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAGAAGGATCTAAACACTGGTG -3'
(R):5'- GTCTGAGTCTGCTGTACCTG -3'

Sequencing Primer
(F):5'- TGTTTTCAACAACCAGGAGAACG -3'
(R):5'- TGCTGCATGAGTGACAGC -3'
Posted On2019-05-13