Incidental Mutation 'R7050:Iqgap3'
ID547515
Institutional Source Beutler Lab
Gene Symbol Iqgap3
Ensembl Gene ENSMUSG00000028068
Gene NameIQ motif containing GTPase activating protein 3
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R7050 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location88081971-88121048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88098913 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 544 (T544A)
Ref Sequence ENSEMBL: ENSMUSP00000142013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071812] [ENSMUST00000195465]
Predicted Effect probably damaging
Transcript: ENSMUST00000071812
AA Change: T544A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071715
Gene: ENSMUSG00000028068
AA Change: T544A

DomainStartEndE-ValueType
CH 36 145 1.72e-14 SMART
internal_repeat_2 197 249 1.75e-5 PROSPERO
internal_repeat_1 209 418 1.31e-14 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 651 1.31e-14 PROSPERO
internal_repeat_2 600 652 1.75e-5 PROSPERO
IQ 730 752 1.18e1 SMART
IQ 760 782 3.76e-6 SMART
IQ 790 812 3.08e-2 SMART
IQ 820 842 1.72e0 SMART
RasGAP 977 1330 1.74e-57 SMART
Blast:RasGAP 1338 1422 1e-9 BLAST
Pfam:RasGAP_C 1434 1555 2e-36 PFAM
low complexity region 1591 1602 N/A INTRINSIC
low complexity region 1615 1630 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195465
AA Change: T544A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142013
Gene: ENSMUSG00000028068
AA Change: T544A

DomainStartEndE-ValueType
CH 36 145 8.5e-17 SMART
internal_repeat_1 209 379 1.33e-7 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 612 1.33e-7 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,973,718 A346V possibly damaging Het
Adcy5 A T 16: 35,303,700 M1250L possibly damaging Het
Arhgef38 T C 3: 133,133,627 probably benign Het
Ascc3 T A 10: 50,840,350 I1944N probably benign Het
Cabin1 G T 10: 75,713,542 P1343Q probably damaging Het
Cbr3 A T 16: 93,690,394 Q155L possibly damaging Het
Cd44 A G 2: 102,814,137 V577A probably damaging Het
Coil C T 11: 88,981,188 T125I possibly damaging Het
Fmo3 T C 1: 162,963,904 N268S probably damaging Het
Fnip2 T C 3: 79,506,270 T248A probably damaging Het
Ggt7 G A 2: 155,506,375 T43I probably benign Het
Gm3250 C A 10: 77,781,980 C188F possibly damaging Het
Iqce G A 5: 140,666,091 S375F possibly damaging Het
Islr A G 9: 58,157,717 L169P probably damaging Het
Kdr G T 5: 75,950,120 T904N probably damaging Het
Mink1 A G 11: 70,612,332 T974A possibly damaging Het
Mycl T C 4: 122,997,020 probably null Het
Nab1 A T 1: 52,490,735 M1K probably null Het
Naip6 C T 13: 100,315,499 G202R probably damaging Het
Nbeal2 G A 9: 110,628,720 S2159L probably damaging Het
Neb A T 2: 52,222,876 M4302K possibly damaging Het
Npy1r A G 8: 66,704,540 D204G probably benign Het
Olfr450 T A 6: 42,817,570 V33D possibly damaging Het
Pkdcc T A 17: 83,215,644 I60N possibly damaging Het
Plcxd3 T C 15: 4,516,718 V68A probably damaging Het
Prss36 G T 7: 127,944,765 R145S possibly damaging Het
Pygl C A 12: 70,219,622 G40C probably damaging Het
Rev1 A G 1: 38,054,271 L1064P probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Serpina3k T C 12: 104,341,144 F212L possibly damaging Het
Slc16a4 A T 3: 107,300,832 E219D probably benign Het
Slc6a20b A T 9: 123,598,543 W434R probably damaging Het
Slco1c1 T A 6: 141,547,926 F278Y probably damaging Het
Tbx21 T G 11: 97,114,770 D123A probably benign Het
Trp73 A G 4: 154,081,442 F35L probably damaging Het
Tspan17 T C 13: 54,796,063 V135A probably benign Het
Uba2 G A 7: 34,146,262 Q479* probably null Het
Ubr2 A G 17: 46,961,602 V889A probably benign Het
Vmn1r45 A T 6: 89,933,721 I89N probably damaging Het
Vmn2r11 A G 5: 109,054,791 I140T probably benign Het
Yipf2 A T 9: 21,592,178 D24E probably benign Het
Zfp251 T G 15: 76,854,296 Q199P possibly damaging Het
Zfp37 A T 4: 62,191,671 N385K possibly damaging Het
Zfp655 G A 5: 145,244,735 E468K probably benign Het
Other mutations in Iqgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Iqgap3 APN 3 88107560 missense probably damaging 1.00
IGL01062:Iqgap3 APN 3 88110122 missense probably benign 0.00
IGL01517:Iqgap3 APN 3 88109396 missense probably benign 0.09
IGL01530:Iqgap3 APN 3 88112303 critical splice acceptor site probably null
IGL01658:Iqgap3 APN 3 88115971 missense possibly damaging 0.89
IGL02027:Iqgap3 APN 3 88087342 missense possibly damaging 0.67
IGL02352:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02359:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02522:Iqgap3 APN 3 88108398 missense possibly damaging 0.94
IGL02717:Iqgap3 APN 3 88098359 missense probably benign 0.01
IGL02971:Iqgap3 APN 3 88090304 missense probably benign 0.30
IGL03079:Iqgap3 APN 3 88113170 missense probably benign
IGL03240:Iqgap3 APN 3 88114974 missense probably benign 0.00
adjutant UTSW 3 88101527 missense possibly damaging 0.51
booster UTSW 3 88113128 missense probably damaging 0.99
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0285:Iqgap3 UTSW 3 88096990 missense probably benign 0.11
R0442:Iqgap3 UTSW 3 88115959 missense probably damaging 0.96
R0490:Iqgap3 UTSW 3 88114056 splice site probably benign
R0569:Iqgap3 UTSW 3 88090725 splice site probably benign
R0747:Iqgap3 UTSW 3 88107503 splice site probably benign
R0843:Iqgap3 UTSW 3 88108431 missense possibly damaging 0.94
R1260:Iqgap3 UTSW 3 88114023 missense probably benign
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1544:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R1662:Iqgap3 UTSW 3 88098401 missense probably benign 0.33
R1686:Iqgap3 UTSW 3 88108356 splice site probably benign
R1748:Iqgap3 UTSW 3 88113980 missense possibly damaging 0.92
R1836:Iqgap3 UTSW 3 88108368 missense probably damaging 1.00
R1972:Iqgap3 UTSW 3 88083928 splice site probably null
R1973:Iqgap3 UTSW 3 88083928 splice site probably null
R2051:Iqgap3 UTSW 3 88120167 missense probably damaging 1.00
R2314:Iqgap3 UTSW 3 88116031 missense probably benign 0.01
R2352:Iqgap3 UTSW 3 88104508 missense possibly damaging 0.94
R2857:Iqgap3 UTSW 3 88107596 nonsense probably null
R2859:Iqgap3 UTSW 3 88107596 nonsense probably null
R3435:Iqgap3 UTSW 3 88094604 missense probably benign 0.00
R3522:Iqgap3 UTSW 3 88090782 missense probably null 0.90
R4281:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4283:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4397:Iqgap3 UTSW 3 88104358 missense probably damaging 1.00
R4414:Iqgap3 UTSW 3 88096986 missense probably benign
R4660:Iqgap3 UTSW 3 88120176 missense probably damaging 1.00
R4872:Iqgap3 UTSW 3 88113128 missense probably damaging 0.99
R4883:Iqgap3 UTSW 3 88107535 missense probably benign
R4915:Iqgap3 UTSW 3 88101527 missense possibly damaging 0.51
R5050:Iqgap3 UTSW 3 88090186 missense probably damaging 1.00
R5130:Iqgap3 UTSW 3 88108854 missense probably damaging 0.97
R5151:Iqgap3 UTSW 3 88117760 missense possibly damaging 0.58
R5645:Iqgap3 UTSW 3 88117699 missense probably damaging 1.00
R5706:Iqgap3 UTSW 3 88115908 missense probably benign 0.03
R5748:Iqgap3 UTSW 3 88109370 missense probably damaging 1.00
R5880:Iqgap3 UTSW 3 88117202 missense possibly damaging 0.67
R5982:Iqgap3 UTSW 3 88091592 nonsense probably null
R6006:Iqgap3 UTSW 3 88091547 missense probably damaging 0.98
R6026:Iqgap3 UTSW 3 88090171 missense probably damaging 1.00
R6188:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R6211:Iqgap3 UTSW 3 88091515 missense probably benign
R6291:Iqgap3 UTSW 3 88089730 critical splice donor site probably null
R6344:Iqgap3 UTSW 3 88082094 critical splice donor site probably null
R6854:Iqgap3 UTSW 3 88096951 missense probably damaging 1.00
R6875:Iqgap3 UTSW 3 88112771 frame shift probably null
R6877:Iqgap3 UTSW 3 88112771 frame shift probably null
R6958:Iqgap3 UTSW 3 88113366 missense possibly damaging 0.89
R7008:Iqgap3 UTSW 3 88112771 frame shift probably null
R7144:Iqgap3 UTSW 3 88116910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTCAGATAGTCTCACTCAG -3'
(R):5'- AGAGTTCATGCCAGGCACAG -3'

Sequencing Primer
(F):5'- TCAGACATCTTCCCCTCAGAC -3'
(R):5'- AGGCACAGCTCTGCTCAAG -3'
Posted On2019-05-13