Incidental Mutation 'R7050:Zfp655'
ID547525
Institutional Source Beutler Lab
Gene Symbol Zfp655
Ensembl Gene ENSMUSG00000007812
Gene Namezinc finger protein 655
Synonyms9030409O18Rik, 2700038I16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.569) question?
Stock #R7050 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145231715-145247302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 145244735 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 468 (E468K)
Ref Sequence ENSEMBL: ENSMUSP00000128969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167316] [ENSMUST00000199322]
Predicted Effect probably benign
Transcript: ENSMUST00000167316
AA Change: E468K

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128969
Gene: ENSMUSG00000007812
AA Change: E468K

DomainStartEndE-ValueType
ZnF_C2H2 243 265 5.29e-5 SMART
ZnF_C2H2 271 293 2.99e-4 SMART
ZnF_C2H2 299 328 1.38e2 SMART
ZnF_C2H2 334 356 6.78e-3 SMART
ZnF_C2H2 361 383 3.99e0 SMART
ZnF_C2H2 411 433 3.63e-3 SMART
ZnF_C2H2 439 461 1.01e-1 SMART
low complexity region 463 475 N/A INTRINSIC
ZnF_C2H2 495 517 6.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199322
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein. The zinc finger proteins are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,973,718 A346V possibly damaging Het
Adcy5 A T 16: 35,303,700 M1250L possibly damaging Het
Arhgef38 T C 3: 133,133,627 probably benign Het
Ascc3 T A 10: 50,840,350 I1944N probably benign Het
Cabin1 G T 10: 75,713,542 P1343Q probably damaging Het
Cbr3 A T 16: 93,690,394 Q155L possibly damaging Het
Cd44 A G 2: 102,814,137 V577A probably damaging Het
Coil C T 11: 88,981,188 T125I possibly damaging Het
Fmo3 T C 1: 162,963,904 N268S probably damaging Het
Fnip2 T C 3: 79,506,270 T248A probably damaging Het
Ggt7 G A 2: 155,506,375 T43I probably benign Het
Gm14025 T C 2: 129,027,971 probably null Het
Gm3250 C A 10: 77,781,980 C188F possibly damaging Het
Iqce G A 5: 140,666,091 S375F possibly damaging Het
Iqgap3 A G 3: 88,098,913 T544A probably damaging Het
Islr A G 9: 58,157,717 L169P probably damaging Het
Kdr G T 5: 75,950,120 T904N probably damaging Het
Mink1 A G 11: 70,612,332 T974A possibly damaging Het
Mms19 A G 19: 41,950,746 probably null Het
Mycl T C 4: 122,997,020 probably null Het
Nab1 A T 1: 52,490,735 M1K probably null Het
Naip6 C T 13: 100,315,499 G202R probably damaging Het
Nbeal2 G A 9: 110,628,720 S2159L probably damaging Het
Neb A T 2: 52,222,876 M4302K possibly damaging Het
Npy1r A G 8: 66,704,540 D204G probably benign Het
Olfr450 T A 6: 42,817,570 V33D possibly damaging Het
Pkdcc T A 17: 83,215,644 I60N possibly damaging Het
Plcxd3 T C 15: 4,516,718 V68A probably damaging Het
Prss36 G T 7: 127,944,765 R145S possibly damaging Het
Pygl C A 12: 70,219,622 G40C probably damaging Het
Rev1 A G 1: 38,054,271 L1064P probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Serpina3k T C 12: 104,341,144 F212L possibly damaging Het
Slc16a4 A T 3: 107,300,832 E219D probably benign Het
Slc6a20b A T 9: 123,598,543 W434R probably damaging Het
Slco1c1 T A 6: 141,547,926 F278Y probably damaging Het
Tbx21 T G 11: 97,114,770 D123A probably benign Het
Trp73 A G 4: 154,081,442 F35L probably damaging Het
Tspan17 T C 13: 54,796,063 V135A probably benign Het
Uba2 G A 7: 34,146,262 Q479* probably null Het
Ubr2 A G 17: 46,961,602 V889A probably benign Het
Unc80 A G 1: 66,550,908 probably null Het
Vmn1r45 A T 6: 89,933,721 I89N probably damaging Het
Vmn2r11 A G 5: 109,054,791 I140T probably benign Het
Yipf2 A T 9: 21,592,178 D24E probably benign Het
Zfp251 T G 15: 76,854,296 Q199P possibly damaging Het
Zfp37 A T 4: 62,191,671 N385K possibly damaging Het
Other mutations in Zfp655
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Zfp655 APN 5 145244145 missense probably damaging 1.00
IGL01679:Zfp655 APN 5 145243827 missense probably damaging 0.96
IGL02379:Zfp655 APN 5 145243955 missense probably benign 0.13
IGL02647:Zfp655 APN 5 145243006 missense probably benign
R0104:Zfp655 UTSW 5 145244015 missense probably damaging 1.00
R0104:Zfp655 UTSW 5 145244015 missense probably damaging 1.00
R0270:Zfp655 UTSW 5 145244457 missense probably damaging 1.00
R0608:Zfp655 UTSW 5 145244057 missense possibly damaging 0.57
R1528:Zfp655 UTSW 5 145244601 missense probably damaging 0.98
R2076:Zfp655 UTSW 5 145244600 missense possibly damaging 0.89
R2119:Zfp655 UTSW 5 145244784 missense probably damaging 0.98
R2375:Zfp655 UTSW 5 145244396 missense probably benign 0.10
R2403:Zfp655 UTSW 5 145244546 missense probably benign 0.00
R4032:Zfp655 UTSW 5 145244048 missense possibly damaging 0.50
R4532:Zfp655 UTSW 5 145244697 missense probably benign 0.06
R4880:Zfp655 UTSW 5 145244358 missense probably damaging 0.99
R5484:Zfp655 UTSW 5 145243635 missense probably benign 0.01
R5529:Zfp655 UTSW 5 145244736 missense probably damaging 0.96
R6193:Zfp655 UTSW 5 145244776 missense probably benign 0.03
R6195:Zfp655 UTSW 5 145243762 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AATATGATGAATGTGGGCTGGC -3'
(R):5'- AACTTGACTAAATGTCTCCCCAAG -3'

Sequencing Primer
(F):5'- TGGGCTGGCCTATGTTAAACAAC -3'
(R):5'- CCAAGTTCACTGCATTCATAAGG -3'
Posted On2019-05-13