Incidental Mutation 'R7051:Itga4'
ID547559
Institutional Source Beutler Lab
Gene Symbol Itga4
Ensembl Gene ENSMUSG00000027009
Gene Nameintegrin alpha 4
SynonymsVLA-4 receptor, alpha 4 subunit
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7051 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location79255426-79333123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79318126 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 788 (V788A)
Ref Sequence ENSEMBL: ENSMUSP00000099718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099972]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099972
AA Change: V788A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099718
Gene: ENSMUSG00000027009
AA Change: V788A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Int_alpha 48 108 5.14e-7 SMART
Int_alpha 191 241 3.45e1 SMART
Int_alpha 247 300 1.89e-5 SMART
Int_alpha 302 358 2.25e-12 SMART
Int_alpha 364 419 1.45e-15 SMART
Int_alpha 426 483 4.52e-3 SMART
SCOP:d1m1xa2 627 770 1e-35 SMART
Blast:Int_alpha 639 676 9e-16 BLAST
SCOP:d1m1xa3 773 948 7e-42 SMART
transmembrane domain 978 1000 N/A INTRINSIC
PDB:4HKC|B 1003 1032 1e-13 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 4 subunit. This subunit associates with a beta 1 or beta 7 subunit to form an integrin that may play a role in cell motility and migration. This integrin is a therapeutic target for the treatment of multiple sclerosis, Crohn's disease and inflammatory bowel disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit embryonic lethality either due to failure of chorioallantoic fusion or cardiac abnormalities, including hemorrhage around the heart and defects in epicardium formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik C T 8: 33,429,173 S7L unknown Het
Aggf1 T C 13: 95,351,617 K674R possibly damaging Het
Ampd1 T C 3: 103,090,073 F264L probably damaging Het
Ankle1 A T 8: 71,407,743 S302C probably damaging Het
Ankrd17 G A 5: 90,366,451 probably benign Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Atp5f1 T C 3: 105,943,767 N205D probably benign Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Atp8b3 C A 10: 80,529,718 V401L probably damaging Het
Cacna1a G A 8: 84,629,915 R1929Q possibly damaging Het
Cadm2 C T 16: 66,882,879 S22N possibly damaging Het
Ccdc177 C T 12: 80,759,153 V116M probably damaging Het
Cdkl2 A T 5: 92,033,225 I185N probably damaging Het
Cfhr2 T A 1: 139,810,978 I282L probably benign Het
Commd2 A T 3: 57,646,686 I198N probably damaging Het
Creb3l2 C T 6: 37,336,265 V365I possibly damaging Het
Dcaf6 A T 1: 165,424,317 N79K possibly damaging Het
Dlg5 T C 14: 24,146,195 N1622D possibly damaging Het
Dock7 C T 4: 98,946,732 R1802H probably damaging Het
Dpy19l2 T C 9: 24,584,493 K643R probably benign Het
Dscam G A 16: 96,819,786 T574M probably benign Het
Fam209 A G 2: 172,474,049 T115A probably damaging Het
Fastkd5 C T 2: 130,614,417 C751Y probably damaging Het
Fat3 C A 9: 16,377,827 L133F probably damaging Het
Frmd6 T C 12: 70,897,396 V516A possibly damaging Het
Fry G A 5: 150,395,169 D955N possibly damaging Het
Fuk A T 8: 110,890,339 I393N probably damaging Het
Gm281 A G 14: 13,828,486 V758A Het
Gm340 A G 19: 41,585,752 D982G probably benign Het
Gm7298 T C 6: 121,775,034 probably null Het
Golga7b T A 19: 42,268,460 *168R probably null Het
Golim4 T A 3: 75,893,002 Q395L probably benign Het
Gxylt2 T A 6: 100,804,576 L404* probably null Het
Hist1h1e A G 13: 23,622,439 V20A probably benign Het
Ighmbp2 G T 19: 3,261,462 S984R probably damaging Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Kifap3 G A 1: 163,794,080 R99H probably damaging Het
Kiss1r T C 10: 79,918,854 S61P probably damaging Het
Krtap6-1 A T 16: 89,031,718 M1L unknown Het
Large2 A T 2: 92,367,022 M411K probably damaging Het
Lingo1 A G 9: 56,620,183 V374A probably benign Het
Lrch1 A G 14: 74,785,522 V637A probably damaging Het
Lyar T C 5: 38,224,680 V2A probably damaging Het
Nell1 C T 7: 50,448,844 S298L unknown Het
Ogfod3 T A 11: 121,195,205 I188F probably damaging Het
Olfr1487 T A 19: 13,619,405 M81K possibly damaging Het
Olfr173 T C 16: 58,797,175 T224A probably benign Het
Opa3 C A 7: 19,245,036 A142E possibly damaging Het
Pald1 T C 10: 61,323,346 R769G probably benign Het
Pappa2 T A 1: 158,957,183 T86S unknown Het
Papss1 T C 3: 131,602,050 Y266H probably damaging Het
Pcdhga7 C A 18: 37,716,941 A667D probably damaging Het
Pcsk5 T A 19: 17,433,731 T1766S probably benign Het
Pds5b T A 5: 150,794,282 N1129K possibly damaging Het
Pop7 T C 5: 137,501,690 N127S probably damaging Het
Ppfibp2 A G 7: 107,717,718 E300G probably damaging Het
Ppp4r3b A G 11: 29,182,507 K87E probably damaging Het
Psmd3 T A 11: 98,682,833 M35K possibly damaging Het
Pus7 A G 5: 23,775,679 V191A probably damaging Het
Sacs A G 14: 61,208,928 M2808V probably benign Het
Scube3 G A 17: 28,167,599 V831I probably benign Het
Sin3a A T 9: 57,103,934 N492Y probably damaging Het
Slc12a3 A G 8: 94,365,944 T998A probably damaging Het
Slc4a1 T C 11: 102,356,258 N501S probably benign Het
Sltm G A 9: 70,559,066 G94R probably damaging Het
Smc4 T A 3: 69,027,502 W650R probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Tcf20 T C 15: 82,856,078 N391D probably damaging Het
Tiam2 G A 17: 3,448,483 V845M probably damaging Het
Tln2 A G 9: 67,346,417 F793L probably benign Het
Uckl1 T C 2: 181,574,244 I193V probably damaging Het
Ugt1a5 A G 1: 88,166,355 M102V probably benign Het
Usp38 G A 8: 81,001,121 P328S possibly damaging Het
Vmn1r189 A G 13: 22,102,115 V184A possibly damaging Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Wdr47 T A 3: 108,618,524 L121Q probably damaging Het
Wiz A G 17: 32,361,533 S315P probably damaging Het
Zc3h13 T C 14: 75,331,157 S1297P probably damaging Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Itga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Itga4 APN 2 79292050 missense probably benign 0.01
IGL01317:Itga4 APN 2 79322661 nonsense probably null
IGL01545:Itga4 APN 2 79315970 splice site probably benign
IGL01570:Itga4 APN 2 79322634 critical splice acceptor site probably null
IGL01575:Itga4 APN 2 79288255 missense probably damaging 1.00
IGL01837:Itga4 APN 2 79315005 missense probably damaging 1.00
IGL01974:Itga4 APN 2 79273127 splice site probably benign
IGL02087:Itga4 APN 2 79292069 missense probably damaging 0.99
IGL02245:Itga4 APN 2 79320559 missense probably benign 0.01
IGL02492:Itga4 APN 2 79255657 utr 5 prime probably benign
IGL02809:Itga4 APN 2 79280577 missense probably damaging 1.00
IGL02998:Itga4 APN 2 79277821 missense possibly damaging 0.88
IGL03008:Itga4 APN 2 79325638 missense probably benign
IGL03282:Itga4 APN 2 79325594 missense probably damaging 0.98
IGL03285:Itga4 APN 2 79279166 missense possibly damaging 0.48
IGL03286:Itga4 APN 2 79289362 missense probably damaging 1.00
R0001:Itga4 UTSW 2 79326587 missense probably damaging 0.99
R0045:Itga4 UTSW 2 79301031 missense probably damaging 1.00
R0276:Itga4 UTSW 2 79321493 missense probably damaging 0.99
R0554:Itga4 UTSW 2 79279117 missense probably damaging 1.00
R0556:Itga4 UTSW 2 79325639 missense probably benign
R0785:Itga4 UTSW 2 79289305 missense possibly damaging 0.89
R0787:Itga4 UTSW 2 79279153 missense probably benign 0.01
R1013:Itga4 UTSW 2 79320503 missense probably benign 0.00
R1237:Itga4 UTSW 2 79279146 missense probably null 0.08
R1295:Itga4 UTSW 2 79322689 missense possibly damaging 0.82
R1471:Itga4 UTSW 2 79287032 missense probably benign 0.26
R1559:Itga4 UTSW 2 79315688 missense probably benign 0.04
R1769:Itga4 UTSW 2 79315706 critical splice donor site probably null
R1931:Itga4 UTSW 2 79313844 critical splice donor site probably null
R2012:Itga4 UTSW 2 79277794 missense probably damaging 1.00
R2241:Itga4 UTSW 2 79301013 missense probably damaging 1.00
R3793:Itga4 UTSW 2 79279128 missense probably benign 0.01
R4133:Itga4 UTSW 2 79322652 missense probably damaging 1.00
R4204:Itga4 UTSW 2 79279161 missense probably damaging 0.97
R4296:Itga4 UTSW 2 79272799 missense probably damaging 1.00
R4777:Itga4 UTSW 2 79313710 missense possibly damaging 0.87
R4906:Itga4 UTSW 2 79288248 missense probably damaging 1.00
R5048:Itga4 UTSW 2 79273034 missense probably benign 0.04
R5087:Itga4 UTSW 2 79315629 missense possibly damaging 0.95
R5212:Itga4 UTSW 2 79280595 missense probably damaging 1.00
R5213:Itga4 UTSW 2 79320576 missense probably benign 0.29
R5421:Itga4 UTSW 2 79316041 nonsense probably null
R5549:Itga4 UTSW 2 79256267 missense probably damaging 0.98
R5907:Itga4 UTSW 2 79322656 missense probably benign
R5917:Itga4 UTSW 2 79287098 missense probably damaging 1.00
R6309:Itga4 UTSW 2 79279085 missense probably damaging 1.00
R6764:Itga4 UTSW 2 79325614 missense probably benign 0.02
R6787:Itga4 UTSW 2 79289265 missense probably damaging 0.97
R6790:Itga4 UTSW 2 79325614 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCAGGCAAGTGTATATATTGGC -3'
(R):5'- GCCCAATCACAGTACTGCAG -3'

Sequencing Primer
(F):5'- CTGAATAGGCATGGCTACCTG -3'
(R):5'- TCACAGTACTGCAGCCCCG -3'
Posted On2019-05-13