Incidental Mutation 'R0611:Ufd1'
ID54764
Institutional Source Beutler Lab
Gene Symbol Ufd1
Ensembl Gene ENSMUSG00000005262
Gene Nameubiquitin recognition factor in ER-associated degradation 1
SynonymsUfd1l, Ufd1
MMRRC Submission 038800-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0611 (G1)
Quality Score173
Status Not validated
Chromosome16
Chromosomal Location18811779-18835261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18814876 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 17 (N17S)
Ref Sequence ENSEMBL: ENSMUSP00000131977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000028] [ENSMUST00000005394] [ENSMUST00000096990] [ENSMUST00000115578] [ENSMUST00000115585] [ENSMUST00000163695] [ENSMUST00000168822] [ENSMUST00000171789] [ENSMUST00000172013]
Predicted Effect probably benign
Transcript: ENSMUST00000000028
SMART Domains Protein: ENSMUSP00000000028
Gene: ENSMUSG00000000028

DomainStartEndE-ValueType
Pfam:CDC45 19 564 1.6e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000005394
AA Change: N17S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005394
Gene: ENSMUSG00000005262
AA Change: N17S

DomainStartEndE-ValueType
Pfam:UFD1 18 194 2.1e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096990
SMART Domains Protein: ENSMUSP00000094753
Gene: ENSMUSG00000000028

DomainStartEndE-ValueType
Pfam:CDC45 18 74 7.9e-24 PFAM
Pfam:CDC45 73 520 4.5e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115578
AA Change: N17S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111241
Gene: ENSMUSG00000005262
AA Change: N17S

DomainStartEndE-ValueType
Pfam:UFD1 19 194 6.1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115585
SMART Domains Protein: ENSMUSP00000111248
Gene: ENSMUSG00000000028

DomainStartEndE-ValueType
Pfam:CDC45 18 136 5.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163695
AA Change: N17S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132341
Gene: ENSMUSG00000005262
AA Change: N17S

DomainStartEndE-ValueType
Pfam:UFD1 18 70 3.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168822
Predicted Effect possibly damaging
Transcript: ENSMUST00000171789
AA Change: N17S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000172013
AA Change: N17S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128186
Gene: ENSMUSG00000005262
AA Change: N17S

DomainStartEndE-ValueType
PDB:2YUJ|A 11 36 2e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232311
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with two other proteins, nuclear protein localization-4 and valosin-containing protein, and this complex is necessary for the degradation of ubiquitinated proteins. In addition, this complex controls the disassembly of the mitotic spindle and the formation of a closed nuclear envelope after mitosis. Mutations in this gene have been associated with Catch 22 syndrome as well as cardiac and craniofacial defects. Alternative splicing results in multiple transcript variants encoding different isoforms. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice heterozygous for a knock-out allele are viable with no obvious heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,252,256 M819K possibly damaging Het
Adamtsl3 T G 7: 82,528,912 C528G probably damaging Het
Akap9 A G 5: 3,954,870 K148E probably benign Het
Akr1b3 A T 6: 34,309,642 D225E probably benign Het
Alms1 C A 6: 85,678,671 Q2931K possibly damaging Het
Ano3 T C 2: 110,885,001 K31E possibly damaging Het
Cdc37 A G 9: 21,142,241 I242T probably damaging Het
Celsr1 T A 15: 85,932,323 K1806N possibly damaging Het
Clpb T A 7: 101,787,749 I707N possibly damaging Het
Cntnap2 A T 6: 47,095,549 Y1017F possibly damaging Het
Creb3l2 A T 6: 37,334,481 S458T probably benign Het
Ctnnd2 C A 15: 31,009,084 T1109K possibly damaging Het
Dcaf10 T A 4: 45,373,011 L425Q probably damaging Het
Dlec1 A G 9: 119,112,099 E239G probably benign Het
Dnah2 T C 11: 69,499,194 K742E probably damaging Het
Dsp A T 13: 38,187,741 R889S probably damaging Het
Dync1h1 T A 12: 110,632,788 M1859K probably damaging Het
Efcab7 T A 4: 99,901,689 N361K probably damaging Het
Eps8l2 T C 7: 141,355,733 V139A probably damaging Het
Fads3 T G 19: 10,041,836 H35Q probably damaging Het
Fam163b C A 2: 27,113,571 V24F probably damaging Het
Gm14496 A T 2: 181,995,111 T121S probably benign Het
Gm4799 C T 10: 82,954,729 noncoding transcript Het
Gm7168 A T 17: 13,949,535 D388V probably benign Het
Gmeb1 A T 4: 132,226,075 L460* probably null Het
Gpc6 T G 14: 117,975,018 F534V probably null Het
Hectd3 A G 4: 116,996,044 D156G possibly damaging Het
Itga6 T C 2: 71,820,060 I150T possibly damaging Het
Kansl1 A G 11: 104,338,186 M863T probably benign Het
Kcnb2 A T 1: 15,710,440 Y512F probably benign Het
Klhdc2 A T 12: 69,300,279 M73L probably benign Het
Ktn1 A G 14: 47,694,616 T667A probably benign Het
Lgsn A C 1: 31,203,655 I273L probably benign Het
Lilra5 A G 7: 4,242,233 D292G probably benign Het
Mrps27 C T 13: 99,405,074 R229C probably damaging Het
Muc5b T G 7: 141,862,436 S3040A probably benign Het
Nat14 T C 7: 4,923,276 S7P probably damaging Het
Nfia A G 4: 97,783,457 I135V possibly damaging Het
Nkd1 G A 8: 88,522,316 A30T probably damaging Het
Nup205 A G 6: 35,225,968 D1370G probably null Het
Olfr282 T C 15: 98,438,287 S273P possibly damaging Het
Olfr344 C G 2: 36,569,556 probably null Het
Olfr507 T A 7: 108,622,287 N158K possibly damaging Het
Olfr633 T C 7: 103,947,193 L209P probably damaging Het
Olfr726 G A 14: 50,083,853 T276I probably damaging Het
Orc1 C T 4: 108,602,032 A466V probably benign Het
Otud7a T A 7: 63,735,890 D367E possibly damaging Het
Pcdhb4 A G 18: 37,308,210 Y191C probably damaging Het
Pclo T C 5: 14,678,775 probably benign Het
Pclo T C 5: 14,712,814 V3767A unknown Het
Prmt1 A T 7: 44,978,801 probably null Het
Ralgapa1 A G 12: 55,795,698 F62S probably damaging Het
Rangrf T C 11: 68,972,692 S163G probably benign Het
Rgs12 C A 5: 35,019,460 A65E probably damaging Het
Rrbp1 T C 2: 143,988,516 N577S probably damaging Het
Sept11 A G 5: 93,167,534 H374R probably damaging Het
Serpina5 T G 12: 104,103,787 N314K probably benign Het
Sgce T C 6: 4,689,621 D395G probably damaging Het
Slc26a9 A T 1: 131,762,761 N501I probably damaging Het
Slc9c1 A G 16: 45,581,602 D784G possibly damaging Het
Snapc2 A G 8: 4,255,676 D207G probably benign Het
Stard9 G T 2: 120,699,257 M1998I probably benign Het
Stk38 A C 17: 28,975,933 F280V possibly damaging Het
Tas2r126 A G 6: 42,435,091 K186R probably damaging Het
Tdp1 A C 12: 99,909,711 D307A probably benign Het
Tead2 A G 7: 45,217,250 D11G probably damaging Het
Tmco4 C A 4: 139,020,072 L211I probably damaging Het
Tmem183a A G 1: 134,352,377 F255S probably damaging Het
Tmem87a C T 2: 120,375,448 G349S possibly damaging Het
Tpte G A 8: 22,336,533 E377K possibly damaging Het
Trim32 T C 4: 65,613,656 F150S possibly damaging Het
Trpc7 T A 13: 56,887,823 K99M probably damaging Het
Ttc22 A G 4: 106,634,184 K195E probably damaging Het
Txn2 G A 15: 77,927,717 P7S probably damaging Het
Ubxn2a G A 12: 4,880,700 T220I probably damaging Het
Unc13a A G 8: 71,649,865 S958P probably damaging Het
Vmn1r202 T A 13: 22,501,654 M198L probably damaging Het
Vmn2r84 G A 10: 130,386,122 A743V probably damaging Het
Washc5 A G 15: 59,341,158 F891S probably damaging Het
Zfp708 T C 13: 67,070,311 T495A probably benign Het
Zfp81 A G 17: 33,334,619 I407T probably benign Het
Zswim5 T C 4: 116,986,677 probably null Het
Other mutations in Ufd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ufd1 APN 16 18827718 unclassified probably benign
IGL00944:Ufd1 APN 16 18825031 missense possibly damaging 0.89
IGL01104:Ufd1 APN 16 18814837 missense probably damaging 1.00
IGL01292:Ufd1 APN 16 18821114 missense probably damaging 0.99
IGL03381:Ufd1 APN 16 18825757 missense probably damaging 0.99
R0730:Ufd1 UTSW 16 18814887 missense probably damaging 0.99
R1527:Ufd1 UTSW 16 18814911 missense probably damaging 1.00
R1755:Ufd1 UTSW 16 18823253 missense probably damaging 1.00
R4078:Ufd1 UTSW 16 18825778 missense possibly damaging 0.86
R4747:Ufd1 UTSW 16 18821082 missense probably damaging 0.98
R5532:Ufd1 UTSW 16 18817930 missense probably damaging 1.00
R6897:Ufd1 UTSW 16 18827100 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AAGGATTTGAGGTTCACCGTGCCG -3'
(R):5'- ACAGGGCTCATAGAGTTTAGGGCAG -3'

Sequencing Primer
(F):5'- ACGCACTGATGACTTGCTATG -3'
(R):5'- TTAGGGCAGGAAAGGTTACTATTC -3'
Posted On2013-07-11