Incidental Mutation 'R0611:Pcdhb4'
ID54770
Institutional Source Beutler Lab
Gene Symbol Pcdhb4
Ensembl Gene ENSMUSG00000045689
Gene Nameprotocadherin beta 4
SynonymsPcdhbD, Pcdhb5A
MMRRC Submission 038800-MU
Accession Numbers

Ncbi RefSeq: NM_053129.3; MGI:2136738

Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0611 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37307455-37311172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37308210 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 191 (Y191C)
Ref Sequence ENSEMBL: ENSMUSP00000059770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056712] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051754
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056712
AA Change: Y191C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059770
Gene: ENSMUSG00000045689
AA Change: Y191C

DomainStartEndE-ValueType
CA 54 131 1.66e0 SMART
CA 155 240 1.07e-19 SMART
CA 264 344 6.03e-28 SMART
CA 367 448 2.57e-22 SMART
CA 472 558 3.36e-26 SMART
CA 588 669 3.48e-10 SMART
Pfam:Cadherin_C_2 685 768 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193025
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,252,256 M819K possibly damaging Het
Adamtsl3 T G 7: 82,528,912 C528G probably damaging Het
Akap9 A G 5: 3,954,870 K148E probably benign Het
Akr1b3 A T 6: 34,309,642 D225E probably benign Het
Alms1 C A 6: 85,678,671 Q2931K possibly damaging Het
Ano3 T C 2: 110,885,001 K31E possibly damaging Het
Cdc37 A G 9: 21,142,241 I242T probably damaging Het
Celsr1 T A 15: 85,932,323 K1806N possibly damaging Het
Clpb T A 7: 101,787,749 I707N possibly damaging Het
Cntnap2 A T 6: 47,095,549 Y1017F possibly damaging Het
Creb3l2 A T 6: 37,334,481 S458T probably benign Het
Ctnnd2 C A 15: 31,009,084 T1109K possibly damaging Het
Dcaf10 T A 4: 45,373,011 L425Q probably damaging Het
Dlec1 A G 9: 119,112,099 E239G probably benign Het
Dnah2 T C 11: 69,499,194 K742E probably damaging Het
Dsp A T 13: 38,187,741 R889S probably damaging Het
Dync1h1 T A 12: 110,632,788 M1859K probably damaging Het
Efcab7 T A 4: 99,901,689 N361K probably damaging Het
Eps8l2 T C 7: 141,355,733 V139A probably damaging Het
Fads3 T G 19: 10,041,836 H35Q probably damaging Het
Fam163b C A 2: 27,113,571 V24F probably damaging Het
Gm14496 A T 2: 181,995,111 T121S probably benign Het
Gm4799 C T 10: 82,954,729 noncoding transcript Het
Gm7168 A T 17: 13,949,535 D388V probably benign Het
Gmeb1 A T 4: 132,226,075 L460* probably null Het
Gpc6 T G 14: 117,975,018 F534V probably null Het
Hectd3 A G 4: 116,996,044 D156G possibly damaging Het
Itga6 T C 2: 71,820,060 I150T possibly damaging Het
Kansl1 A G 11: 104,338,186 M863T probably benign Het
Kcnb2 A T 1: 15,710,440 Y512F probably benign Het
Klhdc2 A T 12: 69,300,279 M73L probably benign Het
Ktn1 A G 14: 47,694,616 T667A probably benign Het
Lgsn A C 1: 31,203,655 I273L probably benign Het
Lilra5 A G 7: 4,242,233 D292G probably benign Het
Mrps27 C T 13: 99,405,074 R229C probably damaging Het
Muc5b T G 7: 141,862,436 S3040A probably benign Het
Nat14 T C 7: 4,923,276 S7P probably damaging Het
Nfia A G 4: 97,783,457 I135V possibly damaging Het
Nkd1 G A 8: 88,522,316 A30T probably damaging Het
Nup205 A G 6: 35,225,968 D1370G probably null Het
Olfr282 T C 15: 98,438,287 S273P possibly damaging Het
Olfr344 C G 2: 36,569,556 probably null Het
Olfr507 T A 7: 108,622,287 N158K possibly damaging Het
Olfr633 T C 7: 103,947,193 L209P probably damaging Het
Olfr726 G A 14: 50,083,853 T276I probably damaging Het
Orc1 C T 4: 108,602,032 A466V probably benign Het
Otud7a T A 7: 63,735,890 D367E possibly damaging Het
Pclo T C 5: 14,678,775 probably benign Het
Pclo T C 5: 14,712,814 V3767A unknown Het
Prmt1 A T 7: 44,978,801 probably null Het
Ralgapa1 A G 12: 55,795,698 F62S probably damaging Het
Rangrf T C 11: 68,972,692 S163G probably benign Het
Rgs12 C A 5: 35,019,460 A65E probably damaging Het
Rrbp1 T C 2: 143,988,516 N577S probably damaging Het
Sept11 A G 5: 93,167,534 H374R probably damaging Het
Serpina5 T G 12: 104,103,787 N314K probably benign Het
Sgce T C 6: 4,689,621 D395G probably damaging Het
Slc26a9 A T 1: 131,762,761 N501I probably damaging Het
Slc9c1 A G 16: 45,581,602 D784G possibly damaging Het
Snapc2 A G 8: 4,255,676 D207G probably benign Het
Stard9 G T 2: 120,699,257 M1998I probably benign Het
Stk38 A C 17: 28,975,933 F280V possibly damaging Het
Tas2r126 A G 6: 42,435,091 K186R probably damaging Het
Tdp1 A C 12: 99,909,711 D307A probably benign Het
Tead2 A G 7: 45,217,250 D11G probably damaging Het
Tmco4 C A 4: 139,020,072 L211I probably damaging Het
Tmem183a A G 1: 134,352,377 F255S probably damaging Het
Tmem87a C T 2: 120,375,448 G349S possibly damaging Het
Tpte G A 8: 22,336,533 E377K possibly damaging Het
Trim32 T C 4: 65,613,656 F150S possibly damaging Het
Trpc7 T A 13: 56,887,823 K99M probably damaging Het
Ttc22 A G 4: 106,634,184 K195E probably damaging Het
Txn2 G A 15: 77,927,717 P7S probably damaging Het
Ubxn2a G A 12: 4,880,700 T220I probably damaging Het
Ufd1 A G 16: 18,814,876 N17S possibly damaging Het
Unc13a A G 8: 71,649,865 S958P probably damaging Het
Vmn1r202 T A 13: 22,501,654 M198L probably damaging Het
Vmn2r84 G A 10: 130,386,122 A743V probably damaging Het
Washc5 A G 15: 59,341,158 F891S probably damaging Het
Zfp708 T C 13: 67,070,311 T495A probably benign Het
Zfp81 A G 17: 33,334,619 I407T probably benign Het
Zswim5 T C 4: 116,986,677 probably null Het
Other mutations in Pcdhb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Pcdhb4 APN 18 37309916 missense possibly damaging 0.68
IGL01319:Pcdhb4 APN 18 37308513 missense probably benign
IGL01325:Pcdhb4 APN 18 37309623 missense probably damaging 1.00
IGL01608:Pcdhb4 APN 18 37308750 missense probably damaging 1.00
IGL01808:Pcdhb4 APN 18 37309014 missense probably damaging 1.00
IGL01962:Pcdhb4 APN 18 37309004 missense possibly damaging 0.90
IGL02280:Pcdhb4 APN 18 37307682 missense probably benign 0.00
IGL02622:Pcdhb4 APN 18 37309668 missense probably benign 0.00
IGL03025:Pcdhb4 APN 18 37309977 missense possibly damaging 0.62
IGL03137:Pcdhb4 APN 18 37308516 missense probably damaging 0.98
P0031:Pcdhb4 UTSW 18 37308885 missense probably damaging 1.00
R0385:Pcdhb4 UTSW 18 37309215 missense probably damaging 1.00
R0671:Pcdhb4 UTSW 18 37307742 missense probably benign 0.01
R0738:Pcdhb4 UTSW 18 37308711 missense probably damaging 1.00
R0853:Pcdhb4 UTSW 18 37309885 nonsense probably null
R0893:Pcdhb4 UTSW 18 37309370 unclassified probably null
R1932:Pcdhb4 UTSW 18 37309541 missense probably benign 0.33
R1945:Pcdhb4 UTSW 18 37308868 missense probably damaging 1.00
R2194:Pcdhb4 UTSW 18 37308735 missense probably damaging 1.00
R2273:Pcdhb4 UTSW 18 37308926 missense probably damaging 1.00
R3807:Pcdhb4 UTSW 18 37309314 missense probably damaging 0.98
R3815:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3816:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3974:Pcdhb4 UTSW 18 37308848 missense possibly damaging 0.55
R4558:Pcdhb4 UTSW 18 37309964 missense probably benign
R4606:Pcdhb4 UTSW 18 37308652 missense probably damaging 1.00
R4615:Pcdhb4 UTSW 18 37308500 missense probably benign 0.02
R4840:Pcdhb4 UTSW 18 37308399 missense possibly damaging 0.60
R5240:Pcdhb4 UTSW 18 37309926 missense possibly damaging 0.78
R5272:Pcdhb4 UTSW 18 37307766 missense probably benign 0.04
R5586:Pcdhb4 UTSW 18 37308981 missense probably damaging 1.00
R5683:Pcdhb4 UTSW 18 37308989 missense probably benign 0.45
R5917:Pcdhb4 UTSW 18 37309566 missense probably damaging 1.00
R6110:Pcdhb4 UTSW 18 37308429 missense possibly damaging 0.80
R6383:Pcdhb4 UTSW 18 37308021 missense probably damaging 1.00
R6877:Pcdhb4 UTSW 18 37309572 missense probably damaging 1.00
R7036:Pcdhb4 UTSW 18 37308782 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACGGAAATGCTCCTAACAATCCCTG -3'
(R):5'- AATCCCTAGCAGAGACCGTGACAAG -3'

Sequencing Primer
(F):5'- TCCTAACAATCCCTGAGAGCG -3'
(R):5'- GGGAACCTGCACCTCATAGAG -3'
Posted On2013-07-11