Incidental Mutation 'R7053:Ppp1r9a'
ID547705
Institutional Source Beutler Lab
Gene Symbol Ppp1r9a
Ensembl Gene ENSMUSG00000032827
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 9A
SynonymsA230094E16Rik, Neurabin I, 2810430P21Rik, neurabin-I, NRB, 4930518N04Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location4902917-5165661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4905670 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 75 (M75K)
Ref Sequence ENSEMBL: ENSMUSP00000135360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035813] [ENSMUST00000168998] [ENSMUST00000175889] [ENSMUST00000175962] [ENSMUST00000176263] [ENSMUST00000176729] [ENSMUST00000177153] [ENSMUST00000177338] [ENSMUST00000177456]
Predicted Effect probably damaging
Transcript: ENSMUST00000035813
AA Change: M75K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827
AA Change: M75K

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 5e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1052 6.41e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168998
AA Change: M75K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126643
Gene: ENSMUSG00000032827
AA Change: M75K

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175889
AA Change: M75K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135629
Gene: ENSMUSG00000032827
AA Change: M75K

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1041 1.72e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175962
AA Change: M75K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135360
Gene: ENSMUSG00000032827
AA Change: M75K

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDB:3HVQ|D 436 466 3e-12 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000176263
AA Change: M75K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134937
Gene: ENSMUSG00000032827
AA Change: M75K

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
low complexity region 643 649 N/A INTRINSIC
Blast:PDZ 763 800 2e-15 BLAST
low complexity region 806 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176729
SMART Domains Protein: ENSMUSP00000134909
Gene: ENSMUSG00000032827

DomainStartEndE-ValueType
low complexity region 96 115 N/A INTRINSIC
PDB:3HVQ|D 116 232 4e-79 PDB
SCOP:d1be9a_ 174 232 5e-9 SMART
Blast:PDZ 193 232 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000177153
AA Change: M75K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135485
Gene: ENSMUSG00000032827
AA Change: M75K

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177338
AA Change: M75K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135634
Gene: ENSMUSG00000032827
AA Change: M75K

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177456
AA Change: M75K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134943
Gene: ENSMUSG00000032827
AA Change: M75K

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1040 1049 N/A INTRINSIC
low complexity region 1103 1114 N/A INTRINSIC
SAM 1183 1249 6.41e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in dopamine-mediated neuromodulation, deficient long-term potentiation at corticostriatal synapses, increased spontaneous excitatory post-synaptic current frequency, and enhanced locomotor activationin response to cocaine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,568,799 C551* probably null Het
Aldh1l1 C A 6: 90,563,438 T235K possibly damaging Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnaic2 T C 11: 114,738,695 S183P probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Gsdma3 T A 11: 98,629,795 M84K possibly damaging Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Nim1k A G 13: 119,727,609 V88A probably damaging Het
Oasl2 A T 5: 114,911,230 I464L possibly damaging Het
Olfr1029 G T 2: 85,976,014 C257F possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rffl T C 11: 82,812,671 K142R probably null Het
Rhou A G 8: 123,654,195 probably benign Het
Rp1l1 A T 14: 64,031,509 T1515S possibly damaging Het
Serpina1b T A 12: 103,732,429 S54C possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Taok3 T A 5: 117,252,562 D529E probably benign Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Zfp948 T A 17: 21,584,859 L37* probably null Het
Other mutations in Ppp1r9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ppp1r9a APN 6 5158195 missense possibly damaging 0.72
IGL00796:Ppp1r9a APN 6 5157014 missense probably benign 0.37
IGL00906:Ppp1r9a APN 6 5157023 missense possibly damaging 0.62
IGL01662:Ppp1r9a APN 6 5115322 missense probably damaging 1.00
IGL01695:Ppp1r9a APN 6 5064003 missense probably damaging 1.00
IGL01807:Ppp1r9a APN 6 5158248 nonsense probably null
IGL02126:Ppp1r9a APN 6 5156229 missense probably damaging 1.00
IGL02423:Ppp1r9a APN 6 4906537 missense probably benign 0.25
IGL03343:Ppp1r9a APN 6 5046015 missense probably damaging 1.00
IGL03365:Ppp1r9a APN 6 5110993 splice site probably benign
R0545:Ppp1r9a UTSW 6 5115357 missense probably benign 0.45
R1126:Ppp1r9a UTSW 6 4906795 missense possibly damaging 0.93
R1137:Ppp1r9a UTSW 6 5159697 missense possibly damaging 0.46
R1443:Ppp1r9a UTSW 6 5057557 missense probably damaging 1.00
R1484:Ppp1r9a UTSW 6 5113712 nonsense probably null
R1545:Ppp1r9a UTSW 6 5156242 critical splice donor site probably null
R1627:Ppp1r9a UTSW 6 4906168 missense possibly damaging 0.50
R1672:Ppp1r9a UTSW 6 5143491 critical splice donor site probably null
R1826:Ppp1r9a UTSW 6 5111060 splice site probably benign
R1834:Ppp1r9a UTSW 6 5113710 missense probably damaging 0.98
R1874:Ppp1r9a UTSW 6 4906348 missense possibly damaging 0.87
R2224:Ppp1r9a UTSW 6 5154074 missense probably benign
R2227:Ppp1r9a UTSW 6 5154074 missense probably benign
R2898:Ppp1r9a UTSW 6 4906558 missense probably benign 0.01
R3606:Ppp1r9a UTSW 6 5113674 missense possibly damaging 0.90
R3732:Ppp1r9a UTSW 6 4906259 unclassified probably benign
R3927:Ppp1r9a UTSW 6 5057531 missense probably damaging 1.00
R4631:Ppp1r9a UTSW 6 4906537 missense possibly damaging 0.62
R4682:Ppp1r9a UTSW 6 4905477 missense possibly damaging 0.48
R4766:Ppp1r9a UTSW 6 5157016 missense probably benign 0.11
R5197:Ppp1r9a UTSW 6 5156177 missense probably damaging 1.00
R5217:Ppp1r9a UTSW 6 5115367 missense probably damaging 1.00
R5493:Ppp1r9a UTSW 6 5159702 missense probably damaging 0.99
R5790:Ppp1r9a UTSW 6 5134363 intron probably benign
R5828:Ppp1r9a UTSW 6 5158200 missense probably damaging 1.00
R5896:Ppp1r9a UTSW 6 5159648 missense probably damaging 1.00
R5930:Ppp1r9a UTSW 6 5157002 critical splice acceptor site probably null
R5990:Ppp1r9a UTSW 6 5134660 missense probably benign 0.05
R6017:Ppp1r9a UTSW 6 4906363 missense probably benign 0.18
R6122:Ppp1r9a UTSW 6 4905509 missense probably damaging 1.00
R6164:Ppp1r9a UTSW 6 5110715 intron probably benign
R6175:Ppp1r9a UTSW 6 4905639 nonsense probably null
R6188:Ppp1r9a UTSW 6 5158113 nonsense probably null
R6233:Ppp1r9a UTSW 6 5077610 missense probably damaging 1.00
R6321:Ppp1r9a UTSW 6 5115151 missense probably damaging 1.00
R6449:Ppp1r9a UTSW 6 5057458 missense probably benign 0.44
R6454:Ppp1r9a UTSW 6 4905827 missense probably damaging 1.00
R6527:Ppp1r9a UTSW 6 5045949 missense probably damaging 1.00
R7233:Ppp1r9a UTSW 6 5134804 missense probably benign
R7238:Ppp1r9a UTSW 6 5159716 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTCAGAAGTGCCTCTCC -3'
(R):5'- ACATCTTTCGAGTCTCCGTG -3'

Sequencing Primer
(F):5'- TCCTCACAGGAATGCGTACAG -3'
(R):5'- GAGTCTCCGTGAACTTAGCATACG -3'
Posted On2019-05-13