Incidental Mutation 'R7054:Ror1'
ID547762
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Namereceptor tyrosine kinase-like orphan receptor 1
Synonyms2810404D04Rik, Ntrkr1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7054 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location100095791-100444765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100442239 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 936 (E936D)
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
Predicted Effect probably benign
Transcript: ENSMUST00000039630
AA Change: E936D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: E936D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik A G 17: 47,437,189 probably null Het
3632451O06Rik C A 14: 49,773,698 S184I probably damaging Het
4930553M12Rik T A 4: 88,868,249 H44L unknown Het
Abcc3 T C 11: 94,365,225 K478R probably benign Het
Ank2 A T 3: 126,943,303 probably benign Het
Apod A G 16: 31,311,132 V2A probably benign Het
Aspg T A 12: 112,126,390 D530E probably damaging Het
Atxn7 A T 14: 14,100,878 T855S probably benign Het
Blmh G C 11: 76,968,625 G351R probably damaging Het
Cc2d2a C T 5: 43,699,979 R454* probably null Het
Cenpp T C 13: 49,465,757 E188G probably damaging Het
Creg2 T C 1: 39,623,208 E252G probably benign Het
Dot1l A G 10: 80,787,023 Y636C probably damaging Het
Dpy30 A G 17: 74,307,840 I36T probably benign Het
Eed A G 7: 89,964,727 probably null Het
Fmn1 A G 2: 113,365,008 D351G unknown Het
Gdpd4 T A 7: 97,973,929 I249N probably damaging Het
Glb1l2 A T 9: 26,765,127 V600D probably null Het
Gm13889 A T 2: 93,957,114 probably benign Het
Gm17654 T A 14: 43,575,870 N188Y Het
Gm3327 T C 14: 44,126,275 F112S Het
H2-Ab1 T C 17: 34,263,342 S11P probably benign Het
Hcn4 T C 9: 58,855,717 S522P unknown Het
Hfm1 T C 5: 106,896,043 T576A probably benign Het
Hoxa1 A G 6: 52,158,200 S8P probably damaging Het
Hoxd13 A G 2: 74,669,025 Y239C probably damaging Het
Ifih1 T A 2: 62,610,515 I485L probably benign Het
Ift52 G A 2: 163,029,796 V183M probably damaging Het
Ikbkb A G 8: 22,671,642 V410A possibly damaging Het
Il22ra1 G A 4: 135,751,162 V515I probably benign Het
Klk1b3 A T 7: 44,201,439 I132F probably damaging Het
Limk2 T C 11: 3,355,448 T206A possibly damaging Het
Llph A T 10: 120,231,335 probably benign Het
Lrrc26 T A 2: 25,290,075 D29E probably benign Het
Ltbp4 A G 7: 27,307,766 probably null Het
Mageb3 A T 2: 121,954,492 V243E probably damaging Het
Mfhas1 T C 8: 35,588,638 V89A probably benign Het
Mycbp2 G A 14: 103,156,098 T2899I possibly damaging Het
Ncor1 T C 11: 62,384,793 D530G probably null Het
Olfr1117-ps1 T A 2: 87,284,431 M47K probably benign Het
Olfr681 C T 7: 105,121,963 R169* probably null Het
Pax4 A G 6: 28,446,323 I57T probably damaging Het
Peg12 T C 7: 62,463,963 I129V possibly damaging Het
Pex6 G A 17: 46,720,521 A416T probably benign Het
Pgghg G A 7: 140,944,718 R326H probably benign Het
Pgk2 T A 17: 40,208,475 M21L probably benign Het
Polh A T 17: 46,198,716 W64R probably benign Het
Rassf7 T A 7: 141,217,643 H256Q probably benign Het
Rc3h2 A G 2: 37,375,246 M1184T probably benign Het
Slco1b2 A T 6: 141,672,248 T440S probably damaging Het
Specc1 T A 11: 62,117,778 V40E probably damaging Het
Tarbp1 T A 8: 126,474,495 S191C possibly damaging Het
Timm22 A G 11: 76,407,245 E14G possibly damaging Het
Tpp2 T A 1: 43,983,158 D905E probably damaging Het
Trav7-5 T C 14: 53,531,299 L108P probably damaging Het
Ttc37 G A 13: 76,134,960 A769T probably damaging Het
Ttc9b A G 7: 27,654,242 T106A probably benign Het
Ttn T C 2: 76,714,668 S32697G probably damaging Het
Usp17la T G 7: 104,861,307 L373R probably benign Het
Vmn1r113 A G 7: 20,787,502 N73S probably benign Het
Vmn1r42 T C 6: 89,845,069 T173A possibly damaging Het
Vmn2r106 A G 17: 20,278,920 V243A probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r25 T A 6: 123,823,610 D591V probably damaging Het
Zc3h13 T C 14: 75,321,787 S379P probably benign Het
Zfp870 T C 17: 32,883,482 Y292C probably damaging Het
Zfp977 A T 7: 42,580,362 N246K possibly damaging Het
Zp1 G A 19: 10,918,740 T207M probably damaging Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100333743 missense probably damaging 1.00
IGL00939:Ror1 APN 4 100441226 missense probably benign 0.01
IGL01408:Ror1 APN 4 100333787 missense probably damaging 1.00
IGL01678:Ror1 APN 4 100425968 missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100409771 missense probably damaging 1.00
IGL01985:Ror1 APN 4 100425964 missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100441184 missense probably damaging 1.00
IGL02634:Ror1 APN 4 100426110 missense probably benign 0.00
IGL02995:Ror1 APN 4 100334525 splice site probably benign
IGL03033:Ror1 APN 4 100411895 missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100407945 splice site probably null
F5770:Ror1 UTSW 4 100440933 missense probably damaging 0.99
R0256:Ror1 UTSW 4 100409745 missense probably benign 0.20
R0417:Ror1 UTSW 4 100412000 missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100441520 missense probably damaging 1.00
R1034:Ror1 UTSW 4 100333620 nonsense probably null
R1278:Ror1 UTSW 4 100441878 missense possibly damaging 0.69
R1368:Ror1 UTSW 4 100441137 missense possibly damaging 0.94
R1437:Ror1 UTSW 4 100412109 missense probably benign
R1441:Ror1 UTSW 4 100440983 missense probably benign
R1544:Ror1 UTSW 4 100441986 missense probably damaging 1.00
R1717:Ror1 UTSW 4 100302938 missense probably benign
R1857:Ror1 UTSW 4 100441503 missense probably damaging 1.00
R2018:Ror1 UTSW 4 100407841 nonsense probably null
R2051:Ror1 UTSW 4 100407868 nonsense probably null
R2127:Ror1 UTSW 4 100442093 missense probably benign
R2132:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2133:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2176:Ror1 UTSW 4 100441874 missense probably damaging 0.99
R2431:Ror1 UTSW 4 100441155 missense probably damaging 1.00
R2896:Ror1 UTSW 4 100096280 missense unknown
R3005:Ror1 UTSW 4 100441764 missense probably damaging 0.99
R3780:Ror1 UTSW 4 100412117 missense probably benign 0.34
R3850:Ror1 UTSW 4 100442160 missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100407923 missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100407910 missense probably damaging 0.99
R4863:Ror1 UTSW 4 100409804 missense probably damaging 0.99
R4871:Ror1 UTSW 4 100425998 missense probably benign
R4990:Ror1 UTSW 4 100441964 missense probably benign
R5023:Ror1 UTSW 4 100425932 missense probably benign 0.01
R5028:Ror1 UTSW 4 100411936 missense possibly damaging 0.67
R5079:Ror1 UTSW 4 100441422 missense probably damaging 1.00
R5294:Ror1 UTSW 4 100425938 missense probably benign 0.00
R5538:Ror1 UTSW 4 100441011 missense probably benign
R6339:Ror1 UTSW 4 100411931 missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100409912 missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100442106 missense probably benign
R6733:Ror1 UTSW 4 100426055 missense probably benign
R7022:Ror1 UTSW 4 100407911 missense probably damaging 1.00
R7121:Ror1 UTSW 4 100302945 missense probably benign 0.00
V7580:Ror1 UTSW 4 100440933 missense probably damaging 0.99
V7583:Ror1 UTSW 4 100440933 missense probably damaging 0.99
X0020:Ror1 UTSW 4 100426090 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCCTCATCAGGATCCAATC -3'
(R):5'- ATGGAGTGTAAATCCCACAATGCG -3'

Sequencing Primer
(F):5'- TCAGGAAGCAAACGTTCCTTTGC -3'
(R):5'- GTAAATCCCACAATGCGTCCTATTTC -3'
Posted On2019-05-13