Incidental Mutation 'R7054:Gdpd4'
ID547778
Institutional Source Beutler Lab
Gene Symbol Gdpd4
Ensembl Gene ENSMUSG00000035582
Gene Nameglycerophosphodiester phosphodiesterase domain containing 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7054 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location97919955-98049663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97973929 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 249 (I249N)
Ref Sequence ENSEMBL: ENSMUSP00000131960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041860] [ENSMUST00000170049]
Predicted Effect probably damaging
Transcript: ENSMUST00000041860
AA Change: I249N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036772
Gene: ENSMUSG00000035582
AA Change: I249N

DomainStartEndE-ValueType
transmembrane domain 65 84 N/A INTRINSIC
transmembrane domain 104 135 N/A INTRINSIC
transmembrane domain 148 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 241 263 N/A INTRINSIC
Pfam:GDPD 281 440 1.4e-19 PFAM
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170049
AA Change: I249N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131960
Gene: ENSMUSG00000035582
AA Change: I249N

DomainStartEndE-ValueType
transmembrane domain 65 84 N/A INTRINSIC
transmembrane domain 104 135 N/A INTRINSIC
transmembrane domain 148 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 241 263 N/A INTRINSIC
Pfam:GDPD 281 439 3.4e-21 PFAM
transmembrane domain 543 565 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik A G 17: 47,437,189 probably null Het
3632451O06Rik C A 14: 49,773,698 S184I probably damaging Het
4930553M12Rik T A 4: 88,868,249 H44L unknown Het
Abcc3 T C 11: 94,365,225 K478R probably benign Het
Ank2 A T 3: 126,943,303 probably benign Het
Apod A G 16: 31,311,132 V2A probably benign Het
Aspg T A 12: 112,126,390 D530E probably damaging Het
Atxn7 A T 14: 14,100,878 T855S probably benign Het
Blmh G C 11: 76,968,625 G351R probably damaging Het
Cc2d2a C T 5: 43,699,979 R454* probably null Het
Cenpp T C 13: 49,465,757 E188G probably damaging Het
Creg2 T C 1: 39,623,208 E252G probably benign Het
Dot1l A G 10: 80,787,023 Y636C probably damaging Het
Dpy30 A G 17: 74,307,840 I36T probably benign Het
Eed A G 7: 89,964,727 probably null Het
Fmn1 A G 2: 113,365,008 D351G unknown Het
Fra10ac1 C T 19: 38,224,119 probably benign Het
Glb1l2 A T 9: 26,765,127 V600D probably null Het
Gm13889 A T 2: 93,957,114 probably benign Het
Gm17654 T A 14: 43,575,870 N188Y Het
Gm3327 T C 14: 44,126,275 F112S Het
H2-Ab1 T C 17: 34,263,342 S11P probably benign Het
Hcn4 T C 9: 58,855,717 S522P unknown Het
Hfm1 T C 5: 106,896,043 T576A probably benign Het
Hoxa1 A G 6: 52,158,200 S8P probably damaging Het
Hoxd13 A G 2: 74,669,025 Y239C probably damaging Het
Ifih1 T A 2: 62,610,515 I485L probably benign Het
Ift52 G A 2: 163,029,796 V183M probably damaging Het
Ikbkb A G 8: 22,671,642 V410A possibly damaging Het
Il22ra1 G A 4: 135,751,162 V515I probably benign Het
Klk1b3 A T 7: 44,201,439 I132F probably damaging Het
Limk2 T C 11: 3,355,448 T206A possibly damaging Het
Llph A T 10: 120,231,335 probably benign Het
Lrrc26 T A 2: 25,290,075 D29E probably benign Het
Ltbp4 A G 7: 27,307,766 probably null Het
Mageb3 A T 2: 121,954,492 V243E probably damaging Het
Mfhas1 T C 8: 35,588,638 V89A probably benign Het
Mycbp2 G A 14: 103,156,098 T2899I possibly damaging Het
Nckap5 A T 1: 126,258,712 probably null Het
Ncor1 T C 11: 62,384,793 D530G probably null Het
Olfr1117-ps1 T A 2: 87,284,431 M47K probably benign Het
Olfr681 C T 7: 105,121,963 R169* probably null Het
Pax4 A G 6: 28,446,323 I57T probably damaging Het
Peg12 T C 7: 62,463,963 I129V possibly damaging Het
Pex6 G A 17: 46,720,521 A416T probably benign Het
Pgghg G A 7: 140,944,718 R326H probably benign Het
Pgk2 T A 17: 40,208,475 M21L probably benign Het
Polh A T 17: 46,198,716 W64R probably benign Het
Rassf7 T A 7: 141,217,643 H256Q probably benign Het
Rc3h2 A G 2: 37,375,246 M1184T probably benign Het
Ror1 A T 4: 100,442,239 E936D probably benign Het
Slco1b2 A T 6: 141,672,248 T440S probably damaging Het
Specc1 T A 11: 62,117,778 V40E probably damaging Het
Tarbp1 T A 8: 126,474,495 S191C possibly damaging Het
Timm22 A G 11: 76,407,245 E14G possibly damaging Het
Tpp2 T A 1: 43,983,158 D905E probably damaging Het
Trav7-5 T C 14: 53,531,299 L108P probably damaging Het
Ttc37 G A 13: 76,134,960 A769T probably damaging Het
Ttc9b A G 7: 27,654,242 T106A probably benign Het
Ttn T C 2: 76,714,668 S32697G probably damaging Het
Usp17la T G 7: 104,861,307 L373R probably benign Het
Vmn1r113 A G 7: 20,787,502 N73S probably benign Het
Vmn1r42 T C 6: 89,845,069 T173A possibly damaging Het
Vmn2r106 A G 17: 20,278,920 V243A probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r25 T A 6: 123,823,610 D591V probably damaging Het
Zc3h13 T C 14: 75,321,787 S379P probably benign Het
Zfp870 T C 17: 32,883,482 Y292C probably damaging Het
Zfp977 A T 7: 42,580,362 N246K possibly damaging Het
Zp1 G A 19: 10,918,740 T207M probably damaging Het
Other mutations in Gdpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Gdpd4 APN 7 98004271 missense probably damaging 1.00
IGL01292:Gdpd4 APN 7 98014954 splice site probably benign
IGL01317:Gdpd4 APN 7 97998258 missense possibly damaging 0.74
IGL02678:Gdpd4 APN 7 97974377 splice site probably benign
IGL02822:Gdpd4 APN 7 97971924 missense possibly damaging 0.82
IGL02987:Gdpd4 APN 7 97961551 splice site probably benign
R0022:Gdpd4 UTSW 7 97982875 missense probably damaging 1.00
R0331:Gdpd4 UTSW 7 97973008 missense probably benign 0.11
R0882:Gdpd4 UTSW 7 97966298 missense probably damaging 1.00
R1425:Gdpd4 UTSW 7 97974012 missense probably benign 0.03
R1469:Gdpd4 UTSW 7 97974466 splice site probably null
R1469:Gdpd4 UTSW 7 97974466 splice site probably null
R1870:Gdpd4 UTSW 7 97972955 missense probably benign 0.00
R4747:Gdpd4 UTSW 7 97961633 missense possibly damaging 0.80
R5017:Gdpd4 UTSW 7 98004275 nonsense probably null
R5208:Gdpd4 UTSW 7 98014911 missense probably benign 0.11
R5290:Gdpd4 UTSW 7 97966336 missense possibly damaging 0.94
R5398:Gdpd4 UTSW 7 97971978 missense probably benign 0.00
R5605:Gdpd4 UTSW 7 98006300 missense probably benign 0.41
R5715:Gdpd4 UTSW 7 97961597 missense probably benign 0.00
R5990:Gdpd4 UTSW 7 98040930 missense probably benign 0.00
R6269:Gdpd4 UTSW 7 97974462 missense probably damaging 1.00
R6314:Gdpd4 UTSW 7 97973953 missense probably damaging 0.98
R6817:Gdpd4 UTSW 7 97957830 missense probably benign 0.00
R6884:Gdpd4 UTSW 7 97972175 missense probably damaging 1.00
Z1088:Gdpd4 UTSW 7 97966309 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCCTGTGTATGTATATCTAACCCC -3'
(R):5'- GCTGACCAGGAGTTAGATGACC -3'

Sequencing Primer
(F):5'- TGTATATCTAACCCCCTGAAAGAGG -3'
(R):5'- CCAGGAGTTAGATGACCTCAGTTC -3'
Posted On2019-05-13