Incidental Mutation 'R7058:Dchs1'
ID548064
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Namedachsous cadherin related 1
Synonyms3110041P15Rik, C130033F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7058 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105752990-105787654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105757021 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 2335 (C2335R)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033184] [ENSMUST00000078482] [ENSMUST00000210066]
Predicted Effect probably benign
Transcript: ENSMUST00000033184
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078482
AA Change: C2335R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: C2335R

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140959
Predicted Effect probably benign
Transcript: ENSMUST00000210066
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,626,130 I419T possibly damaging Het
Afap1 T C 5: 35,962,260 V294A probably benign Het
Amotl1 T A 9: 14,575,236 Q454L possibly damaging Het
Ap2a1 T C 7: 44,900,791 S961G probably damaging Het
Asxl3 A G 18: 22,517,674 K907E probably damaging Het
BC028528 A T 3: 95,885,011 L137I possibly damaging Het
Cand1 A T 10: 119,211,754 N610K probably benign Het
Cat A G 2: 103,474,353 I109T probably benign Het
Ccdc18 T C 5: 108,193,798 V853A probably benign Het
Chd4 C A 6: 125,108,442 D805E possibly damaging Het
Cnih1 A C 14: 46,780,195 F77V probably damaging Het
Cntd1 A T 11: 101,287,426 I284F probably damaging Het
Col6a3 C A 1: 90,828,037 E177* probably null Het
Cpxm2 T A 7: 132,143,679 D139V probably benign Het
Cyp1a2 G T 9: 57,677,242 R510S probably damaging Het
D2hgdh T C 1: 93,835,374 S294P probably damaging Het
Disc1 G T 8: 125,250,985 C719F probably damaging Het
Dnah14 A C 1: 181,698,049 D2180A probably benign Het
Dopey2 G A 16: 93,776,990 R1582Q probably benign Het
Dsg2 A T 18: 20,592,275 H481L probably benign Het
Epha6 A G 16: 59,682,650 S965P probably damaging Het
Esrrg G T 1: 188,150,306 L253F probably damaging Het
Exoc6b T C 6: 84,854,722 K438R probably damaging Het
Fam98a C A 17: 75,538,389 R454L unknown Het
Fam98c A T 7: 29,155,883 probably null Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Galnt13 A G 2: 55,098,575 T470A probably damaging Het
Ggt7 A T 2: 155,503,095 probably null Het
Golim4 T C 3: 75,878,650 E606G probably damaging Het
Gpd2 G A 2: 57,307,100 probably null Het
Grin2b T C 6: 135,780,306 M386V probably damaging Het
Hfm1 A T 5: 106,911,440 S239T probably benign Het
Hmcn1 G A 1: 150,773,890 T615I probably benign Het
Hook2 G A 8: 84,997,411 E446K possibly damaging Het
Hsd3b1 C T 3: 98,857,815 probably null Het
Igsf9b A G 9: 27,322,854 Y421C probably damaging Het
Il21 A G 3: 37,232,480 L29P probably damaging Het
Ildr1 A G 16: 36,722,368 S421G probably benign Het
Kat2b C A 17: 53,665,866 T736K probably benign Het
Kcng1 A G 2: 168,262,609 V439A probably damaging Het
Kif21a A T 15: 90,948,903 probably null Het
Lat A G 7: 126,369,146 probably null Het
Mastl T A 2: 23,133,413 K433* probably null Het
Mettl2 A G 11: 105,128,893 R119G probably benign Het
Mia2 C T 12: 59,184,235 P1223L possibly damaging Het
Mkrn2os G T 6: 115,586,674 D133E probably benign Het
Mslnl A G 17: 25,743,212 T195A probably benign Het
Muc16 T G 9: 18,639,755 T5081P probably benign Het
Mylpf G C 7: 127,213,967 R110P probably damaging Het
Myo19 G T 11: 84,907,368 C738F possibly damaging Het
Nat8f4 T A 6: 85,901,289 N84I possibly damaging Het
Nol8 C T 13: 49,676,386 R1104C probably damaging Het
Notch1 A T 2: 26,463,818 D1932E probably benign Het
Nsun3 A T 16: 62,776,300 C152S possibly damaging Het
Olfr116 A G 17: 37,623,706 F310L probably benign Het
Opcml G A 9: 28,675,211 W75* probably null Het
Pcdh7 G A 5: 57,722,240 E1046K probably damaging Het
Pcdhb9 T A 18: 37,403,281 V776D probably benign Het
Pla2g4a A G 1: 149,851,352 L551S probably damaging Het
Plaa G A 4: 94,569,823 Q637* probably null Het
Plekhh1 A T 12: 79,075,430 E1099V probably damaging Het
Ppp4r1 A T 17: 65,829,500 N551Y probably benign Het
R3hdm2 T C 10: 127,484,513 V554A probably damaging Het
Rab44 A G 17: 29,138,176 probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasgrf2 T C 13: 91,886,402 T1119A probably damaging Het
Rims2 A G 15: 39,585,648 D1194G probably damaging Het
Scarb1 A T 5: 125,297,230 C280S probably damaging Het
Sde2 T C 1: 180,866,262 F439S probably damaging Het
Setd5 T C 6: 113,115,571 I304T probably benign Het
Sipa1l1 A G 12: 82,403,122 E1106G probably benign Het
Sis T G 3: 72,903,607 S1694R probably damaging Het
Smad9 T A 3: 54,786,193 F181Y probably benign Het
Smg1 A G 7: 118,198,279 probably benign Het
Sspo T C 6: 48,448,582 Y46H probably damaging Het
Tdrd12 A G 7: 35,478,109 M940T unknown Het
Tmem44 G T 16: 30,547,395 T71K possibly damaging Het
Tmf1 T A 6: 97,156,950 E1009V probably damaging Het
Ttc39a C T 4: 109,431,566 R288W probably damaging Het
Ttc9c G A 19: 8,818,827 probably benign Het
Usp28 T A 9: 49,039,156 Y634N probably damaging Het
Vmn1r211 C T 13: 22,851,893 M201I probably benign Het
Vmn2r54 T A 7: 12,615,795 Q620L possibly damaging Het
Vps13c T C 9: 67,923,828 L1580P probably benign Het
Vrk3 C A 7: 44,768,466 F308L probably damaging Het
Zdbf2 T A 1: 63,307,404 H1647Q possibly damaging Het
Zfp984 A T 4: 147,755,545 M283K probably benign Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105758743 missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105758029 missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105758424 missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105755261 missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105758207 missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105757943 missense probably benign
IGL01292:Dchs1 APN 7 105760891 missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105762211 missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105772283 missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105771927 missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105755302 missense probably benign 0.00
IGL01829:Dchs1 APN 7 105755397 missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105759105 missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105757591 missense probably benign 0.00
IGL02012:Dchs1 APN 7 105764297 missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105764887 missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105772569 missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105755188 missense probably benign 0.22
IGL02430:Dchs1 APN 7 105771971 missense probably benign 0.34
IGL02500:Dchs1 APN 7 105755806 missense probably benign
IGL02741:Dchs1 APN 7 105757323 missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105756491 missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105755072 missense probably damaging 1.00
P0026:Dchs1 UTSW 7 105758405 missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105757588 missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105758971 missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105755836 missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105755932 missense probably benign 0.18
R0091:Dchs1 UTSW 7 105766094 splice site probably benign
R0193:Dchs1 UTSW 7 105764983 missense probably benign 0.40
R0395:Dchs1 UTSW 7 105758538 missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105765927 missense probably benign 0.00
R0480:Dchs1 UTSW 7 105771489 missense probably benign 0.14
R0485:Dchs1 UTSW 7 105772727 missense probably benign 0.00
R0566:Dchs1 UTSW 7 105759195 missense probably benign 0.00
R0571:Dchs1 UTSW 7 105771996 missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105758778 missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105764255 missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105763449 missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105772349 missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105764984 missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105757714 missense probably benign
R1241:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105755571 missense probably benign 0.40
R1427:Dchs1 UTSW 7 105766191 missense probably benign 0.06
R1458:Dchs1 UTSW 7 105755244 missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105772071 nonsense probably null
R1524:Dchs1 UTSW 7 105764525 missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105758931 missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105772040 missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105771861 missense probably benign 0.01
R1577:Dchs1 UTSW 7 105765955 missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105762770 missense probably benign 0.24
R1676:Dchs1 UTSW 7 105754921 missense probably benign 0.40
R1794:Dchs1 UTSW 7 105771720 missense probably benign 0.02
R1826:Dchs1 UTSW 7 105757627 missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105764156 missense probably benign 0.00
R1924:Dchs1 UTSW 7 105772280 missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105765902 missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105764201 missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105772398 missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105762548 missense probably benign 0.00
R2007:Dchs1 UTSW 7 105755325 missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105764204 missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105754094 missense probably benign
R2474:Dchs1 UTSW 7 105755074 missense probably benign 0.37
R2474:Dchs1 UTSW 7 105772838 missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105762316 missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105757085 missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105761635 missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105762563 missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105765140 missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105766190 missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105753759 missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105754852 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105754765 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105758973 missense probably benign
R4588:Dchs1 UTSW 7 105756041 missense probably benign
R4613:Dchs1 UTSW 7 105772724 missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105754355 missense probably benign 0.02
R4696:Dchs1 UTSW 7 105764627 missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4725:Dchs1 UTSW 7 105765552 missense probably damaging 1.00
R4738:Dchs1 UTSW 7 105758673 missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105771620 missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105765926 missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105755730 missense probably benign 0.00
R4909:Dchs1 UTSW 7 105766255 missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105772177 missense probably benign 0.09
R5109:Dchs1 UTSW 7 105765014 missense probably benign
R5126:Dchs1 UTSW 7 105753517 missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105755658 missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105754602 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105772055 missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105755293 missense probably benign 0.11
R5623:Dchs1 UTSW 7 105772769 missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105772809 missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105755748 missense probably benign 0.01
R5743:Dchs1 UTSW 7 105771596 missense probably benign
R5759:Dchs1 UTSW 7 105764176 missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105773040 missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105772035 missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105759166 missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105755925 missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105754095 missense probably benign 0.08
R6065:Dchs1 UTSW 7 105755421 missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105760925 missense probably benign
R6137:Dchs1 UTSW 7 105765106 missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105764938 missense probably benign 0.05
R6363:Dchs1 UTSW 7 105758472 missense probably benign 0.12
R6466:Dchs1 UTSW 7 105764541 missense probably benign 0.09
R6544:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105758806 missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105762913 missense probably benign 0.17
R6632:Dchs1 UTSW 7 105761878 missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105757003 missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105763503 missense possibly damaging 0.91
R7064:Dchs1 UTSW 7 105763185 missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105761871 missense probably benign 0.04
R7191:Dchs1 UTSW 7 105765439 missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105755131 nonsense probably null
R7380:Dchs1 UTSW 7 105758628 missense probably benign 0.35
R7438:Dchs1 UTSW 7 105754948 missense probably benign 0.30
R7496:Dchs1 UTSW 7 105761859 missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105772373 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCATTGCTCCAACAGGAAG -3'
(R):5'- AAGAGGTACGAATGGCTCCTG -3'

Sequencing Primer
(F):5'- GAACCCCAGATCCAGGTATG -3'
(R):5'- GTGAGGATAGTTCTGCAATCACCC -3'
Posted On2019-05-13