Incidental Mutation 'R7058:Asxl3'
ID548103
Institutional Source Beutler Lab
Gene Symbol Asxl3
Ensembl Gene ENSMUSG00000045215
Gene Nameadditional sex combs like 3, transcriptional regulator
SynonymsD930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R7058 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location22344883-22530227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22517674 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 907 (K907E)
Ref Sequence ENSEMBL: ENSMUSP00000112793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]
Predicted Effect probably damaging
Transcript: ENSMUST00000097655
AA Change: K907E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: K907E

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 173 305 5.6e-50 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2139 2202 9.8e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120223
AA Change: K907E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: K907E

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 179 304 1.3e-36 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2138 2202 1.9e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,626,130 I419T possibly damaging Het
Afap1 T C 5: 35,962,260 V294A probably benign Het
Amotl1 T A 9: 14,575,236 Q454L possibly damaging Het
Ap2a1 T C 7: 44,900,791 S961G probably damaging Het
BC028528 A T 3: 95,885,011 L137I possibly damaging Het
Cand1 A T 10: 119,211,754 N610K probably benign Het
Cat A G 2: 103,474,353 I109T probably benign Het
Ccdc18 T C 5: 108,193,798 V853A probably benign Het
Chd4 C A 6: 125,108,442 D805E possibly damaging Het
Cnih1 A C 14: 46,780,195 F77V probably damaging Het
Cntd1 A T 11: 101,287,426 I284F probably damaging Het
Col6a3 C A 1: 90,828,037 E177* probably null Het
Cpxm2 T A 7: 132,143,679 D139V probably benign Het
Cyp1a2 G T 9: 57,677,242 R510S probably damaging Het
D2hgdh T C 1: 93,835,374 S294P probably damaging Het
Dchs1 A G 7: 105,757,021 C2335R probably benign Het
Disc1 G T 8: 125,250,985 C719F probably damaging Het
Dnah14 A C 1: 181,698,049 D2180A probably benign Het
Dopey2 G A 16: 93,776,990 R1582Q probably benign Het
Dsg2 A T 18: 20,592,275 H481L probably benign Het
Epha6 A G 16: 59,682,650 S965P probably damaging Het
Esrrg G T 1: 188,150,306 L253F probably damaging Het
Exoc6b T C 6: 84,854,722 K438R probably damaging Het
Fam98a C A 17: 75,538,389 R454L unknown Het
Fam98c A T 7: 29,155,883 probably null Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Galnt13 A G 2: 55,098,575 T470A probably damaging Het
Golim4 T C 3: 75,878,650 E606G probably damaging Het
Grin2b T C 6: 135,780,306 M386V probably damaging Het
Hfm1 A T 5: 106,911,440 S239T probably benign Het
Hmcn1 G A 1: 150,773,890 T615I probably benign Het
Hook2 G A 8: 84,997,411 E446K possibly damaging Het
Igsf9b A G 9: 27,322,854 Y421C probably damaging Het
Il21 A G 3: 37,232,480 L29P probably damaging Het
Ildr1 A G 16: 36,722,368 S421G probably benign Het
Kat2b C A 17: 53,665,866 T736K probably benign Het
Kcng1 A G 2: 168,262,609 V439A probably damaging Het
Lat A G 7: 126,369,146 probably null Het
Mastl T A 2: 23,133,413 K433* probably null Het
Mettl2 A G 11: 105,128,893 R119G probably benign Het
Mia2 C T 12: 59,184,235 P1223L possibly damaging Het
Mkrn2os G T 6: 115,586,674 D133E probably benign Het
Mslnl A G 17: 25,743,212 T195A probably benign Het
Muc16 T G 9: 18,639,755 T5081P probably benign Het
Mylpf G C 7: 127,213,967 R110P probably damaging Het
Myo19 G T 11: 84,907,368 C738F possibly damaging Het
Nat8f4 T A 6: 85,901,289 N84I possibly damaging Het
Nol8 C T 13: 49,676,386 R1104C probably damaging Het
Notch1 A T 2: 26,463,818 D1932E probably benign Het
Nsun3 A T 16: 62,776,300 C152S possibly damaging Het
Olfr116 A G 17: 37,623,706 F310L probably benign Het
Opcml G A 9: 28,675,211 W75* probably null Het
Pcdh7 G A 5: 57,722,240 E1046K probably damaging Het
Pcdhb9 T A 18: 37,403,281 V776D probably benign Het
Pla2g4a A G 1: 149,851,352 L551S probably damaging Het
Plaa G A 4: 94,569,823 Q637* probably null Het
Plekhh1 A T 12: 79,075,430 E1099V probably damaging Het
Ppp4r1 A T 17: 65,829,500 N551Y probably benign Het
R3hdm2 T C 10: 127,484,513 V554A probably damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasgrf2 T C 13: 91,886,402 T1119A probably damaging Het
Rims2 A G 15: 39,585,648 D1194G probably damaging Het
Scarb1 A T 5: 125,297,230 C280S probably damaging Het
Sde2 T C 1: 180,866,262 F439S probably damaging Het
Setd5 T C 6: 113,115,571 I304T probably benign Het
Sipa1l1 A G 12: 82,403,122 E1106G probably benign Het
Sis T G 3: 72,903,607 S1694R probably damaging Het
Smad9 T A 3: 54,786,193 F181Y probably benign Het
Smg1 A G 7: 118,198,279 probably benign Het
Sspo T C 6: 48,448,582 Y46H probably damaging Het
Tdrd12 A G 7: 35,478,109 M940T unknown Het
Tmem44 G T 16: 30,547,395 T71K possibly damaging Het
Tmf1 T A 6: 97,156,950 E1009V probably damaging Het
Ttc39a C T 4: 109,431,566 R288W probably damaging Het
Ttc9c G A 19: 8,818,827 probably benign Het
Usp28 T A 9: 49,039,156 Y634N probably damaging Het
Vmn1r211 C T 13: 22,851,893 M201I probably benign Het
Vmn2r54 T A 7: 12,615,795 Q620L possibly damaging Het
Vps13c T C 9: 67,923,828 L1580P probably benign Het
Vrk3 C A 7: 44,768,466 F308L probably damaging Het
Zdbf2 T A 1: 63,307,404 H1647Q possibly damaging Het
Zfp984 A T 4: 147,755,545 M283K probably benign Het
Other mutations in Asxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Asxl3 APN 18 22525223 missense probably benign 0.41
IGL00510:Asxl3 APN 18 22523565 missense probably damaging 1.00
IGL00864:Asxl3 APN 18 22522446 missense probably benign 0.06
IGL01074:Asxl3 APN 18 22522845 missense probably damaging 1.00
IGL01305:Asxl3 APN 18 22516446 missense probably benign 0.06
IGL01313:Asxl3 APN 18 22517459 missense probably benign 0.41
IGL01349:Asxl3 APN 18 22524237 missense probably benign 0.28
IGL01529:Asxl3 APN 18 22517655 missense probably damaging 1.00
IGL01574:Asxl3 APN 18 22523564 missense probably benign 0.06
IGL01583:Asxl3 APN 18 22516597 missense probably benign 0.01
IGL01619:Asxl3 APN 18 22523328 missense probably damaging 1.00
IGL01720:Asxl3 APN 18 22525325 missense probably damaging 1.00
IGL01816:Asxl3 APN 18 22522488 missense probably benign 0.10
IGL01828:Asxl3 APN 18 22525558 utr 3 prime probably benign
IGL01903:Asxl3 APN 18 22434576 missense probably benign 0.00
IGL01906:Asxl3 APN 18 22522281 missense probably benign 0.01
IGL01962:Asxl3 APN 18 22522445 missense probably benign 0.00
IGL01991:Asxl3 APN 18 22516162 missense probably damaging 1.00
IGL02064:Asxl3 APN 18 22524344 missense possibly damaging 0.59
IGL02187:Asxl3 APN 18 22524978 missense probably damaging 0.99
IGL02219:Asxl3 APN 18 22453626 missense possibly damaging 0.81
IGL02309:Asxl3 APN 18 22522453 missense probably benign 0.01
IGL02478:Asxl3 APN 18 22523013 missense possibly damaging 0.77
IGL02506:Asxl3 APN 18 22452399 missense probably benign 0.19
IGL02660:Asxl3 APN 18 22524345 missense probably damaging 0.98
IGL02828:Asxl3 APN 18 22524661 missense possibly damaging 0.87
IGL02863:Asxl3 APN 18 22523484 missense probably benign 0.01
IGL03001:Asxl3 APN 18 22517398 missense probably damaging 1.00
IGL03143:Asxl3 APN 18 22522974 missense probably benign 0.43
ANU22:Asxl3 UTSW 18 22516446 missense probably benign 0.06
R0145:Asxl3 UTSW 18 22453605 missense probably damaging 1.00
R0201:Asxl3 UTSW 18 22523154 missense probably benign
R0207:Asxl3 UTSW 18 22411496 splice site probably benign
R0230:Asxl3 UTSW 18 22452326 splice site probably benign
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0344:Asxl3 UTSW 18 22517611 missense probably benign 0.00
R0519:Asxl3 UTSW 18 22523520 missense possibly damaging 0.85
R0520:Asxl3 UTSW 18 22522986 missense probably damaging 0.96
R0548:Asxl3 UTSW 18 22521792 splice site probably benign
R0626:Asxl3 UTSW 18 22522880 missense probably benign 0.02
R0711:Asxl3 UTSW 18 22524451 missense probably benign 0.01
R0744:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R0833:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R1035:Asxl3 UTSW 18 22525049 missense probably damaging 1.00
R1170:Asxl3 UTSW 18 22524507 missense probably benign 0.00
R1372:Asxl3 UTSW 18 22410009 missense probably benign 0.00
R1440:Asxl3 UTSW 18 22525224 missense probably benign 0.13
R1463:Asxl3 UTSW 18 22516753 missense possibly damaging 0.94
R1471:Asxl3 UTSW 18 22516354 missense probably damaging 1.00
R1618:Asxl3 UTSW 18 22516987 missense probably damaging 1.00
R1720:Asxl3 UTSW 18 22452435 missense probably damaging 1.00
R1819:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R1824:Asxl3 UTSW 18 22522068 missense probably damaging 1.00
R1851:Asxl3 UTSW 18 22517739 missense probably damaging 0.97
R1989:Asxl3 UTSW 18 22452363 missense probably damaging 1.00
R2041:Asxl3 UTSW 18 22523451 missense probably benign 0.02
R2174:Asxl3 UTSW 18 22453644 missense possibly damaging 0.76
R2175:Asxl3 UTSW 18 22516595 missense probably benign
R2443:Asxl3 UTSW 18 22411539 missense probably benign 0.12
R2907:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R4246:Asxl3 UTSW 18 22525500 missense probably damaging 1.00
R4254:Asxl3 UTSW 18 22524366 missense possibly damaging 0.58
R4441:Asxl3 UTSW 18 22524233 missense probably damaging 0.97
R4660:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4661:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4674:Asxl3 UTSW 18 22517738 missense probably damaging 1.00
R4749:Asxl3 UTSW 18 22516769 missense probably damaging 0.99
R4817:Asxl3 UTSW 18 22525454 missense probably damaging 0.97
R4935:Asxl3 UTSW 18 22523312 missense probably benign 0.06
R5062:Asxl3 UTSW 18 22522718 missense possibly damaging 0.92
R5064:Asxl3 UTSW 18 22516019 missense probably benign 0.00
R5065:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5066:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5067:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5133:Asxl3 UTSW 18 22516708 missense probably damaging 1.00
R5174:Asxl3 UTSW 18 22523115 missense probably benign 0.45
R5183:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5294:Asxl3 UTSW 18 22516439 missense possibly damaging 0.77
R5416:Asxl3 UTSW 18 22524494 missense probably damaging 1.00
R5587:Asxl3 UTSW 18 22525247 missense probably benign 0.28
R5873:Asxl3 UTSW 18 22516085 missense probably benign 0.04
R6240:Asxl3 UTSW 18 22465508 missense probably damaging 1.00
R6242:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R6316:Asxl3 UTSW 18 22522782 missense probably damaging 1.00
R6348:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R6518:Asxl3 UTSW 18 22516340 missense probably damaging 0.96
R6605:Asxl3 UTSW 18 22517077 nonsense probably null
R6704:Asxl3 UTSW 18 22517305 missense probably benign 0.00
R6706:Asxl3 UTSW 18 22453609 missense probably damaging 1.00
R6786:Asxl3 UTSW 18 22525440 missense probably damaging 1.00
R6799:Asxl3 UTSW 18 22465400 nonsense probably null
R6811:Asxl3 UTSW 18 22522911 missense possibly damaging 0.87
R6817:Asxl3 UTSW 18 22523580 missense probably benign 0.00
R6830:Asxl3 UTSW 18 22525388 missense probably benign 0.45
R6957:Asxl3 UTSW 18 22522091 missense probably damaging 1.00
R7015:Asxl3 UTSW 18 22523921 missense probably benign 0.00
R7135:Asxl3 UTSW 18 22517701 nonsense probably null
R7135:Asxl3 UTSW 18 22517702 missense probably damaging 1.00
R7231:Asxl3 UTSW 18 22411499 critical splice acceptor site probably null
R7231:Asxl3 UTSW 18 22517540 missense probably damaging 1.00
Z1088:Asxl3 UTSW 18 22516772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTCCTCCAGCTAAACTACAG -3'
(R):5'- CAGTTTGCTATGTGAAGCCC -3'

Sequencing Primer
(F):5'- GCTAAACTACAGGACAAGCAATATG -3'
(R):5'- GTTTGCTATGTGAAGCCCTAAAAGAG -3'
Posted On2019-05-13