Incidental Mutation 'R7060:Nhsl1'
ID548201
Institutional Source Beutler Lab
Gene Symbol Nhsl1
Ensembl Gene ENSMUSG00000039835
Gene NameNHS-like 1
Synonyms5730409E15Rik, D10Bwg0940e, A630035H13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7060 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location18318985-18533892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18526503 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1159 (T1159M)
Ref Sequence ENSEMBL: ENSMUSP00000147021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037341] [ENSMUST00000100054] [ENSMUST00000162891] [ENSMUST00000207038]
Predicted Effect probably damaging
Transcript: ENSMUST00000037341
AA Change: T1129M

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040799
Gene: ENSMUSG00000039835
AA Change: T1129M

DomainStartEndE-ValueType
Pfam:NHS 258 906 1.6e-246 PFAM
low complexity region 918 938 N/A INTRINSIC
low complexity region 942 950 N/A INTRINSIC
low complexity region 958 970 N/A INTRINSIC
low complexity region 992 1024 N/A INTRINSIC
low complexity region 1171 1197 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
low complexity region 1442 1460 N/A INTRINSIC
low complexity region 1484 1503 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100054
AA Change: T1125M

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097631
Gene: ENSMUSG00000039835
AA Change: T1125M

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
Pfam:NHS 253 902 7.3e-250 PFAM
low complexity region 914 934 N/A INTRINSIC
low complexity region 938 946 N/A INTRINSIC
low complexity region 954 966 N/A INTRINSIC
low complexity region 988 1020 N/A INTRINSIC
low complexity region 1167 1193 N/A INTRINSIC
low complexity region 1369 1381 N/A INTRINSIC
low complexity region 1438 1456 N/A INTRINSIC
low complexity region 1480 1499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159299
SMART Domains Protein: ENSMUSP00000124629
Gene: ENSMUSG00000039835

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162891
SMART Domains Protein: ENSMUSP00000124072
Gene: ENSMUSG00000039835

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
Pfam:NHS 253 902 2.1e-250 PFAM
low complexity region 914 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207038
AA Change: T1159M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A C 8: 129,219,132 I404R probably benign Het
5730559C18Rik T C 1: 136,220,197 K339R possibly damaging Het
Abcg4 T A 9: 44,275,128 T535S probably benign Het
Adamts19 A T 18: 58,837,640 R99* probably null Het
Alg6 C T 4: 99,761,961 L473F possibly damaging Het
Ankar A T 1: 72,656,113 N893K probably benign Het
Ankrd54 G A 15: 79,055,539 A183V possibly damaging Het
Anpep G T 7: 79,841,794 T153K probably benign Het
Arap1 A G 7: 101,409,357 probably null Het
Aspg A T 12: 112,122,953 T392S probably benign Het
B230307C23Rik A C 16: 98,010,131 R68S probably benign Het
Bdp1 G C 13: 100,059,494 N1253K probably damaging Het
Ccrl2 G A 9: 111,055,614 S272F probably damaging Het
Cdon T C 9: 35,486,909 L974P probably damaging Het
Celsr1 C A 15: 86,032,655 E372D probably benign Het
Cers1 A T 8: 70,315,905 M16L possibly damaging Het
Col2a1 G T 15: 97,976,141 Q1387K unknown Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dppa2 T A 16: 48,315,713 S143T probably benign Het
Dpy19l1 A T 9: 24,423,123 M583K possibly damaging Het
Eno3 A T 11: 70,661,419 D299V possibly damaging Het
Epha8 C T 4: 136,931,158 V969M probably damaging Het
Fcgbp A T 7: 28,091,933 H873L probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fntb A C 12: 76,887,875 N173T possibly damaging Het
Gins2 T A 8: 120,582,141 M125L probably benign Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Herpud1 C A 8: 94,390,763 H116N probably benign Het
Hoga1 C A 19: 42,060,246 Y134* probably null Het
Il10ra A G 9: 45,256,224 I343T probably benign Het
Inpp5j C T 11: 3,500,133 probably null Het
Itpkb T C 1: 180,333,130 S274P probably damaging Het
Kalrn C T 16: 34,357,048 C249Y probably damaging Het
Klhl35 G C 7: 99,468,458 A70P possibly damaging Het
Lhx1 A G 11: 84,520,282 probably null Het
Lmbrd1 T C 1: 24,692,966 V88A probably benign Het
Macc1 T G 12: 119,447,455 L653V probably damaging Het
Madd T C 2: 91,177,107 D220G probably damaging Het
Mllt10 T A 2: 18,159,560 H300Q possibly damaging Het
Mlxipl G A 5: 135,132,315 A363T possibly damaging Het
Mus81 G T 19: 5,487,793 D78E probably benign Het
Mxd1 A T 6: 86,653,159 L26M probably damaging Het
Nos1ap A G 1: 170,338,125 S190P possibly damaging Het
Nwd1 A C 8: 72,666,694 D195A probably damaging Het
Olfr103 G T 17: 37,336,461 T257N probably benign Het
Olfr1058 T A 2: 86,386,225 R64S possibly damaging Het
Olfr424 A T 1: 174,136,810 D22V probably benign Het
Olfr892-ps1 G A 9: 38,190,096 V124I probably damaging Het
Otof T C 5: 30,388,356 D500G possibly damaging Het
Pcgf5 T A 19: 36,442,939 Y190* probably null Het
Pdcd11 C T 19: 47,110,979 T839I probably benign Het
Ppard G C 17: 28,298,912 S318T probably benign Het
Ppfia2 A G 10: 106,762,109 K178E probably damaging Het
Ppm1n G T 7: 19,279,262 R255S probably damaging Het
Ppp1r21 A G 17: 88,580,544 Y693C probably damaging Het
Ppp2r5d A T 17: 46,687,353 V169E possibly damaging Het
Prc1 A T 7: 80,304,373 T53S probably benign Het
Pwp2 A C 10: 78,173,250 probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Ring1 A G 17: 34,023,390 C48R probably damaging Het
Rpap1 T C 2: 119,773,562 D496G probably damaging Het
Rspo4 C A 2: 151,873,078 Q212K unknown Het
Samd9l T A 6: 3,372,716 D1515V probably damaging Het
Serinc3 T C 2: 163,636,959 T83A probably benign Het
Setd5 A C 6: 113,117,382 D420A probably damaging Het
Sidt2 T C 9: 45,953,246 T62A possibly damaging Het
Smarcal1 T C 1: 72,612,942 V621A probably damaging Het
Srcin1 A G 11: 97,573,885 L12P probably damaging Het
Stx18 G A 5: 38,121,255 D165N possibly damaging Het
Sumf2 A G 5: 129,854,500 K139E possibly damaging Het
Tdo2 A T 3: 81,969,559 I102N probably damaging Het
Tdp1 T A 12: 99,911,688 S410T probably benign Het
Tmem94 A T 11: 115,792,938 I726F probably damaging Het
Ttc21a A G 9: 119,966,676 E1192G probably damaging Het
Ttc8 T C 12: 98,943,467 I52T probably benign Het
Vmn2r99 A T 17: 19,394,564 R849* probably null Het
Wwc1 T C 11: 35,915,176 K77E possibly damaging Het
Xirp2 A T 2: 67,515,608 E2731V probably damaging Het
Zfp423 G A 8: 87,782,879 T258I probably damaging Het
Other mutations in Nhsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Nhsl1 APN 10 18527609 missense probably benign 0.07
IGL01121:Nhsl1 APN 10 18511710 missense probably damaging 1.00
IGL01775:Nhsl1 APN 10 18524474 missense probably damaging 0.99
IGL02143:Nhsl1 APN 10 18511635 missense possibly damaging 0.74
IGL02606:Nhsl1 APN 10 18511637 missense probably damaging 1.00
IGL02642:Nhsl1 APN 10 18408390 missense possibly damaging 0.96
IGL02866:Nhsl1 APN 10 18527607 missense probably damaging 0.99
IGL03263:Nhsl1 APN 10 18498079 nonsense probably null
IGL03380:Nhsl1 APN 10 18523879 nonsense probably null
PIT4651001:Nhsl1 UTSW 10 18408435 missense probably damaging 0.98
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0116:Nhsl1 UTSW 10 18525242 nonsense probably null
R0245:Nhsl1 UTSW 10 18525108 missense probably damaging 1.00
R0254:Nhsl1 UTSW 10 18472985 missense probably damaging 1.00
R0288:Nhsl1 UTSW 10 18524046 missense probably damaging 1.00
R0648:Nhsl1 UTSW 10 18531726 missense possibly damaging 0.92
R1055:Nhsl1 UTSW 10 18525475 missense probably benign 0.08
R1300:Nhsl1 UTSW 10 18408461 missense probably benign
R1384:Nhsl1 UTSW 10 18408513 missense probably null 0.96
R1453:Nhsl1 UTSW 10 18531575 missense probably damaging 1.00
R1523:Nhsl1 UTSW 10 18408355 missense probably benign
R1595:Nhsl1 UTSW 10 18526348 missense probably damaging 0.98
R1786:Nhsl1 UTSW 10 18524664 missense probably benign 0.28
R1836:Nhsl1 UTSW 10 18524905 missense possibly damaging 0.87
R1878:Nhsl1 UTSW 10 18524279 missense probably damaging 1.00
R2013:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2014:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2015:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R3115:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3116:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3754:Nhsl1 UTSW 10 18516034 missense probably damaging 0.99
R4342:Nhsl1 UTSW 10 18526689 missense probably damaging 1.00
R4595:Nhsl1 UTSW 10 18527609 missense probably benign 0.07
R4604:Nhsl1 UTSW 10 18531410 missense probably damaging 0.99
R4666:Nhsl1 UTSW 10 18531405 missense probably damaging 1.00
R5223:Nhsl1 UTSW 10 18526326 missense probably damaging 1.00
R5258:Nhsl1 UTSW 10 18524322 nonsense probably null
R5707:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R5796:Nhsl1 UTSW 10 18524250 missense probably benign 0.06
R5960:Nhsl1 UTSW 10 18526976 missense probably benign
R6190:Nhsl1 UTSW 10 18470041 intron probably benign
R6272:Nhsl1 UTSW 10 18524505 missense probably benign 0.01
R6677:Nhsl1 UTSW 10 18525862 missense probably damaging 0.98
R6714:Nhsl1 UTSW 10 18524711 missense possibly damaging 0.74
R6765:Nhsl1 UTSW 10 18531314 missense probably benign 0.01
R6892:Nhsl1 UTSW 10 18524343 missense probably damaging 1.00
R7049:Nhsl1 UTSW 10 18531638 missense probably damaging 0.99
R7236:Nhsl1 UTSW 10 18525764 missense probably damaging 1.00
R7305:Nhsl1 UTSW 10 18531686 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCACCACAGAAGCTTTGCAG -3'
(R):5'- GGTACCACCAGGAACAGTTTGG -3'

Sequencing Primer
(F):5'- CCACAGAAGCTTTGCAGATGGTG -3'
(R):5'- ACCAGGAACAGTTTGGGCTTC -3'
Posted On2019-05-13