Mutagenetix > Incidental Mutation

Incidental Mutation 'R7060:Hoga1'

548232

Institutional Source

Beutler Lab

Gene Symbol

Hoga1

Ensembl Gene

ENSMUSG00000025176

Gene Name

4-hydroxy-2-oxoglutarate aldolase 1

Synonyms

0610010D20Rik, Npl2, Dhdpsl

MMRRC Submission

045157-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R7060 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42034049-42059392 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 42048685 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 134 (Y134*)

Ref Sequence

ENSEMBL: ENSMUSP00000080414 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081714] [ENSMUST00000172244]

AlphaFold

Q9DCU9

Predicted Effect

probably null
Transcript: ENSMUST00000081714
AA Change: Y134*

SMART Domains

Protein: ENSMUSP00000080414
Gene: ENSMUSG00000025176
AA Change: Y134*

Domain	Start	End	E-Value	Type
DHDPS	28	319	8.34e-81	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172244

SMART Domains

Protein: ENSMUSP00000126037
Gene: ENSMUSG00000025176

Domain	Start	End	E-Value	Type
Pfam:DHDPS	57	156	5.8e-11	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

96% (78/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The authors of PMID:20797690 cloned this gene while searching for genes in a region of chromosome 10 linked to primary hyperoxalurea type III. They noted that even though the encoded protein has been described as a mitochondrial dihydrodipicolinate synthase-like enzyme, it shares little homology with E. coli dihydrodipicolinate synthase (Dhdps), particularly in the putative substrate-binding region. Moreover, neither lysine biosynthesis nor sialic acid metabolism, for which Dhdps is responsible, occurs in vertebrate mitochondria. They propose that this gene encodes mitochondrial 4-hydroxyl-2-oxoglutarate aldolase (EC 4.1.3.16), which catalyzes the final step in the metabolic pathway of hydroxyproline, releasing glyoxylate and pyruvate. This gene is predominantly expressed in the liver and kidney, and mutations in this gene are found in patients with primary hyperoxalurea type III. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal urinary excretion of oxalate but show increased urine 2,4-dihydroxyglutarate (DHG) levels especially when challenged by the inclusion of hydroxyproline in the diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	T	A	9: 44,186,425 (GRCm39)	T535S	probably benign	Het
Adamts19	A	T	18: 58,970,712 (GRCm39)	R99*	probably null	Het
Alg6	C	T	4: 99,650,198 (GRCm39)	L473F	possibly damaging	Het
Ankar	A	T	1: 72,695,272 (GRCm39)	N893K	probably benign	Het
Ankrd54	G	A	15: 78,939,739 (GRCm39)	A183V	possibly damaging	Het
Anpep	G	T	7: 79,491,542 (GRCm39)	T153K	probably benign	Het
Arap1	A	G	7: 101,058,564 (GRCm39)		probably null	Het
Aspg	A	T	12: 112,089,387 (GRCm39)	T392S	probably benign	Het
B230307C23Rik	A	C	16: 97,811,331 (GRCm39)	R68S	probably benign	Het
Bdp1	G	C	13: 100,196,002 (GRCm39)	N1253K	probably damaging	Het
Ccrl2	G	A	9: 110,884,682 (GRCm39)	S272F	probably damaging	Het
Cdon	T	C	9: 35,398,205 (GRCm39)	L974P	probably damaging	Het
Celsr1	C	A	15: 85,916,856 (GRCm39)	E372D	probably benign	Het
Cers1	A	T	8: 70,768,555 (GRCm39)	M16L	possibly damaging	Het
Col2a1	G	T	15: 97,874,022 (GRCm39)	Q1387K	unknown	Het
Ddx39b	G	A	17: 35,471,726 (GRCm39)	V291M	probably damaging	Het
Dppa2	T	A	16: 48,136,076 (GRCm39)	S143T	probably benign	Het
Dpy19l1	A	T	9: 24,334,419 (GRCm39)	M583K	possibly damaging	Het
Eno3	A	T	11: 70,552,245 (GRCm39)	D299V	possibly damaging	Het
Epha8	C	T	4: 136,658,469 (GRCm39)	V969M	probably damaging	Het
Fcgbp	A	T	7: 27,791,358 (GRCm39)	H873L	probably benign	Het
Fhad1	CGG	CG	4: 141,645,602 (GRCm39)		probably null	Het
Fntb	A	C	12: 76,934,649 (GRCm39)	N173T	possibly damaging	Het
Gins2	T	A	8: 121,308,880 (GRCm39)	M125L	probably benign	Het
Gys1	G	A	7: 45,089,437 (GRCm39)	A199T	probably damaging	Het
Herpud1	C	A	8: 95,117,391 (GRCm39)	H116N	probably benign	Het
Il10ra	A	G	9: 45,167,522 (GRCm39)	I343T	probably benign	Het
Inava	T	C	1: 136,147,935 (GRCm39)	K339R	possibly damaging	Het
Inpp5j	C	T	11: 3,450,133 (GRCm39)		probably null	Het
Itpkb	T	C	1: 180,160,695 (GRCm39)	S274P	probably damaging	Het
Kalrn	C	T	16: 34,177,418 (GRCm39)	C249Y	probably damaging	Het
Klhl35	G	C	7: 99,117,665 (GRCm39)	A70P	possibly damaging	Het
Lhx1	A	G	11: 84,411,108 (GRCm39)		probably null	Het
Lmbrd1	T	C	1: 24,732,047 (GRCm39)	V88A	probably benign	Het
Macc1	T	G	12: 119,411,190 (GRCm39)	L653V	probably damaging	Het
Madd	T	C	2: 91,007,452 (GRCm39)	D220G	probably damaging	Het
Mllt10	T	A	2: 18,164,371 (GRCm39)	H300Q	possibly damaging	Het
Mlxipl	G	A	5: 135,161,169 (GRCm39)	A363T	possibly damaging	Het
Mus81	G	T	19: 5,537,821 (GRCm39)	D78E	probably benign	Het
Mxd1	A	T	6: 86,630,141 (GRCm39)	L26M	probably damaging	Het
Nhsl1	C	T	10: 18,402,251 (GRCm39)	T1159M	probably damaging	Het
Nos1ap	A	G	1: 170,165,694 (GRCm39)	S190P	possibly damaging	Het
Nwd1	A	C	8: 73,393,322 (GRCm39)	D195A	probably damaging	Het
Or12d13	G	T	17: 37,647,352 (GRCm39)	T257N	probably benign	Het
Or6k4	A	T	1: 173,964,376 (GRCm39)	D22V	probably benign	Het
Or8c14-ps1	G	A	9: 38,101,392 (GRCm39)	V124I	probably damaging	Het
Or8k24	T	A	2: 86,216,569 (GRCm39)	R64S	possibly damaging	Het
Otof	T	C	5: 30,545,700 (GRCm39)	D500G	possibly damaging	Het
Pcgf5	T	A	19: 36,420,339 (GRCm39)	Y190*	probably null	Het
Pdcd11	C	T	19: 47,099,418 (GRCm39)	T839I	probably benign	Het
Ppard	G	C	17: 28,517,886 (GRCm39)	S318T	probably benign	Het
Ppfia2	A	G	10: 106,597,970 (GRCm39)	K178E	probably damaging	Het
Ppm1n	G	T	7: 19,013,187 (GRCm39)	R255S	probably damaging	Het
Ppp1r21	A	G	17: 88,887,972 (GRCm39)	Y693C	probably damaging	Het
Ppp2r5d	A	T	17: 46,998,279 (GRCm39)	V169E	possibly damaging	Het
Prc1	A	T	7: 79,954,121 (GRCm39)	T53S	probably benign	Het
Pwp2	A	C	10: 78,009,084 (GRCm39)		probably null	Het
Rab5c	G	A	11: 100,610,789 (GRCm39)	R40C	probably damaging	Het
Ring1	A	G	17: 34,242,364 (GRCm39)	C48R	probably damaging	Het
Rpap1	T	C	2: 119,604,043 (GRCm39)	D496G	probably damaging	Het
Rspo4	C	A	2: 151,714,998 (GRCm39)	Q212K	unknown	Het
Samd9l	T	A	6: 3,372,716 (GRCm39)	D1515V	probably damaging	Het
Serinc3	T	C	2: 163,478,879 (GRCm39)	T83A	probably benign	Het
Setd5	A	C	6: 113,094,343 (GRCm39)	D420A	probably damaging	Het
Sidt2	T	C	9: 45,864,544 (GRCm39)	T62A	possibly damaging	Het
Smarcal1	T	C	1: 72,652,101 (GRCm39)	V621A	probably damaging	Het
Srcin1	A	G	11: 97,464,711 (GRCm39)	L12P	probably damaging	Het
Stx18	G	A	5: 38,278,599 (GRCm39)	D165N	possibly damaging	Het
Sumf2	A	G	5: 129,883,341 (GRCm39)	K139E	possibly damaging	Het
Tdo2	A	T	3: 81,876,866 (GRCm39)	I102N	probably damaging	Het
Tdp1	T	A	12: 99,877,947 (GRCm39)	S410T	probably benign	Het
Tmem94	A	T	11: 115,683,764 (GRCm39)	I726F	probably damaging	Het
Ttc21a	A	G	9: 119,795,742 (GRCm39)	E1192G	probably damaging	Het
Ttc8	T	C	12: 98,909,726 (GRCm39)	I52T	probably benign	Het
Vmn2r99	A	T	17: 19,614,826 (GRCm39)	R849*	probably null	Het
Wwc1	T	C	11: 35,806,003 (GRCm39)	K77E	possibly damaging	Het
Xirp2	A	T	2: 67,345,952 (GRCm39)	E2731V	probably damaging	Het
Zfp1006	A	C	8: 129,945,613 (GRCm39)	I404R	probably benign	Het
Zfp423	G	A	8: 88,509,507 (GRCm39)	T258I	probably damaging	Het

Other mutations in Hoga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eroica	UTSW	19	42,048,685 (GRCm39)	nonsense	probably null
R0555:Hoga1	UTSW	19	42,034,514 (GRCm39)	missense	possibly damaging	0.59
R1225:Hoga1	UTSW	19	42,058,628 (GRCm39)	missense	probably damaging	1.00
R1991:Hoga1	UTSW	19	42,048,459 (GRCm39)	splice site	probably null
R2103:Hoga1	UTSW	19	42,048,459 (GRCm39)	splice site	probably null
R2184:Hoga1	UTSW	19	42,049,830 (GRCm39)	missense	probably damaging	1.00
R5643:Hoga1	UTSW	19	42,048,402 (GRCm39)	missense	probably benign	0.00
R8756:Hoga1	UTSW	19	42,048,716 (GRCm39)	missense	probably benign	0.00
R8772:Hoga1	UTSW	19	42,034,384 (GRCm39)	missense	probably benign
R9101:Hoga1	UTSW	19	42,048,347 (GRCm39)	missense	possibly damaging	0.88
R9254:Hoga1	UTSW	19	42,051,697 (GRCm39)	missense	probably damaging	1.00
R9379:Hoga1	UTSW	19	42,051,697 (GRCm39)	missense	probably damaging	1.00
R9420:Hoga1	UTSW	19	42,048,333 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- TGTGAGGACCCAATGCCTTG -3'
(R):5'- CATACGTATGTCCTAGAGTGGC -3'

Sequencing Primer
(F):5'- TTTCGGGGCAGAATCCAGG -3'
(R):5'- TGTCCTAGAGTGGCTATTAACAGGAC -3'

Posted On

2019-05-13