Incidental Mutation 'R7061:Rrbp1'
ID548241
Institutional Source Beutler Lab
Gene Symbol Rrbp1
Ensembl Gene ENSMUSG00000027422
Gene Nameribosome binding protein 1
SynonymsmRRp15b, mRRp47, mRRp41, 5730465C04Rik, 1700087N07Rik, mRRp0, mRRp15a, mRRp16.8, mRRp10, mRRp5.4, ES/130, mRRp2, mRRp1.8, p180
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R7061 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location143947395-144011263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143989167 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 360 (K360R)
Ref Sequence ENSEMBL: ENSMUSP00000016072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016072] [ENSMUST00000037875]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016072
AA Change: K360R

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000016072
Gene: ENSMUSG00000027422
AA Change: K360R

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Rib_recp_KP_reg 33 171 2.3e-40 PFAM
low complexity region 197 215 N/A INTRINSIC
internal_repeat_2 218 373 2.94e-114 PROSPERO
internal_repeat_1 219 406 7.79e-148 PROSPERO
internal_repeat_1 410 618 7.79e-148 PROSPERO
internal_repeat_2 449 692 2.94e-114 PROSPERO
coiled coil region 757 1126 N/A INTRINSIC
coiled coil region 1167 1321 N/A INTRINSIC
coiled coil region 1342 1455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037875
AA Change: K360R

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040560
Gene: ENSMUSG00000027422
AA Change: K360R

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Rib_recp_KP_reg 33 173 2.8e-47 PFAM
low complexity region 197 215 N/A INTRINSIC
Blast:KISc 470 652 3e-13 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Rrbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Rrbp1 APN 2 143968618 missense possibly damaging 0.93
IGL01636:Rrbp1 APN 2 143947895 unclassified probably benign
IGL01923:Rrbp1 APN 2 143990161 missense probably damaging 1.00
IGL02513:Rrbp1 APN 2 143988430 missense possibly damaging 0.55
IGL02548:Rrbp1 APN 2 143949759 splice site probably benign
IGL02678:Rrbp1 APN 2 143990187 missense probably damaging 0.98
FR4449:Rrbp1 UTSW 2 143967456 frame shift probably null
PIT4378001:Rrbp1 UTSW 2 143974540 missense probably benign 0.00
R0127:Rrbp1 UTSW 2 143989944 missense probably benign 0.21
R0611:Rrbp1 UTSW 2 143988516 missense probably damaging 1.00
R0881:Rrbp1 UTSW 2 143953253 missense probably benign 0.09
R1439:Rrbp1 UTSW 2 143955112 critical splice donor site probably null
R1534:Rrbp1 UTSW 2 143988313 missense probably damaging 1.00
R1604:Rrbp1 UTSW 2 143989390 missense probably damaging 0.99
R1920:Rrbp1 UTSW 2 143988291 missense probably benign 0.16
R1921:Rrbp1 UTSW 2 143988291 missense probably benign 0.16
R2152:Rrbp1 UTSW 2 143954198 missense possibly damaging 0.75
R2153:Rrbp1 UTSW 2 143954198 missense possibly damaging 0.75
R2319:Rrbp1 UTSW 2 143957559 missense probably benign 0.01
R2850:Rrbp1 UTSW 2 143949349 missense probably benign 0.09
R2864:Rrbp1 UTSW 2 143957637 missense probably damaging 0.99
R3433:Rrbp1 UTSW 2 143952280 splice site probably benign
R3707:Rrbp1 UTSW 2 143953277 missense probably benign 0.01
R3837:Rrbp1 UTSW 2 143989558 missense probably damaging 1.00
R4073:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4074:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4076:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4279:Rrbp1 UTSW 2 143963108 missense probably benign 0.16
R4583:Rrbp1 UTSW 2 143988751 missense probably benign 0.03
R4820:Rrbp1 UTSW 2 143964765 missense possibly damaging 0.78
R4829:Rrbp1 UTSW 2 143989687 missense probably benign 0.18
R4836:Rrbp1 UTSW 2 143988417 missense possibly damaging 0.75
R5589:Rrbp1 UTSW 2 143989966 missense probably benign 0.16
R5801:Rrbp1 UTSW 2 143989783 missense probably damaging 1.00
R5806:Rrbp1 UTSW 2 143963331 missense probably benign 0.16
R5955:Rrbp1 UTSW 2 143949677 missense probably benign 0.06
R6102:Rrbp1 UTSW 2 143988393 missense probably damaging 1.00
R6368:Rrbp1 UTSW 2 143989555 missense probably damaging 1.00
R6916:Rrbp1 UTSW 2 143974598 missense probably benign 0.03
R7022:Rrbp1 UTSW 2 143957802 intron probably null
R7136:Rrbp1 UTSW 2 143949680 missense probably benign 0.16
R7291:Rrbp1 UTSW 2 143969462 missense probably benign 0.09
Z1088:Rrbp1 UTSW 2 143974486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTTGATTCTGGGCTCCT -3'
(R):5'- GGCTCAGAACCAAGCTAAGA -3'

Sequencing Primer
(F):5'- CCTTCTTGCCTTGGTTCTGGG -3'
(R):5'- CTCAGAACCAAGCTAAGAAGGGTG -3'
Posted On2019-05-13