Incidental Mutation 'R7062:Lrrc63'
ID548364
Institutional Source Beutler Lab
Gene Symbol Lrrc63
Ensembl Gene ENSMUSG00000021997
Gene Nameleucine rich repeat containing 63
Synonyms4921509B22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7062 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location75084303-75130881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75086297 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 496 (S496T)
Ref Sequence ENSEMBL: ENSMUSP00000022574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022574]
Predicted Effect probably benign
Transcript: ENSMUST00000022574
AA Change: S496T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000022574
Gene: ENSMUSG00000021997
AA Change: S496T

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 276 310 N/A INTRINSIC
LRR 412 434 2.82e0 SMART
LRR 435 458 1.45e1 SMART
LRR 481 504 1.53e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,599,146 D1370V probably damaging Het
Ackr1 A T 1: 173,332,115 I279N possibly damaging Het
Adcy10 A G 1: 165,538,522 H536R probably benign Het
Adgrb3 T C 1: 25,826,085 T226A possibly damaging Het
Apol10b T A 15: 77,585,273 M235L probably benign Het
Arhgap44 T C 11: 65,011,932 T570A probably benign Het
Astn1 A G 1: 158,688,511 probably null Het
Camsap3 A G 8: 3,607,834 probably benign Het
Ccdc73 C T 2: 104,951,878 A193V probably damaging Het
Ccl20 G A 1: 83,117,814 C32Y probably damaging Het
Cdk11b A G 4: 155,626,811 E16G probably damaging Het
Celsr2 T A 3: 108,402,510 N1591I possibly damaging Het
Col5a2 T C 1: 45,417,625 E306G probably benign Het
Cpa1 C T 6: 30,640,677 A106V probably benign Het
Ctdspl G A 9: 119,037,470 R199H probably damaging Het
Cyfip2 G A 11: 46,260,832 P547S probably damaging Het
Cyp2c37 A T 19: 39,995,546 probably null Het
Dnajc16 A G 4: 141,766,690 F549L probably damaging Het
Dnm3 T A 1: 162,134,491 K50* probably null Het
Eci1 C T 17: 24,426,740 probably benign Het
Eif2b4 C T 5: 31,192,831 C49Y probably benign Het
Emc3 A T 6: 113,522,796 I56N probably damaging Het
Enthd1 A G 15: 80,452,544 L563P probably damaging Het
Ercc4 T A 16: 13,132,947 I635K probably damaging Het
Espl1 A C 15: 102,298,896 N265T probably benign Het
Fads2 T C 19: 10,065,598 probably null Het
Fam186a G A 15: 99,933,640 probably benign Het
Fastkd1 A T 2: 69,704,322 I368K possibly damaging Het
Fat1 G A 8: 44,950,216 M1I probably null Het
Foxj1 T C 11: 116,331,993 E328G probably benign Het
Gfod2 T C 8: 105,722,876 probably benign Het
Gm6525 C T 3: 84,174,891 R40C probably benign Het
Gna12 G A 5: 140,785,485 T144I probably benign Het
Ighv9-3 T C 12: 114,141,092 M11V probably benign Het
Kcnj14 T C 7: 45,817,890 Y344C probably damaging Het
Ltn1 T C 16: 87,427,603 T78A probably damaging Het
Matr3 T A 18: 35,579,019 probably null Het
Mcpt4 A G 14: 56,060,668 M142T probably benign Het
Mroh7 A G 4: 106,683,980 F1154S probably damaging Het
Mrpl1 G T 5: 96,213,791 L12F probably benign Het
Myo3b G A 2: 70,217,157 V308I probably benign Het
Nfasc A G 1: 132,601,969 probably null Het
Npc1l1 T A 11: 6,217,807 M995L probably benign Het
Nvl A G 1: 181,112,334 I617T probably benign Het
Oas1h C A 5: 120,861,465 probably benign Het
Oasl2 T A 5: 114,911,091 Y197* probably null Het
Olfr1156 T C 2: 87,950,224 E3G probably benign Het
Olfr262 T C 19: 12,240,725 N312S probably benign Het
Olfr495 C T 7: 108,395,830 R237* probably null Het
Olfr598 T C 7: 103,329,086 V200A probably benign Het
Olfr728 A G 14: 50,140,450 L63P probably damaging Het
Olfr955 A T 9: 39,470,057 I223N probably benign Het
Orc6 T C 8: 85,302,908 V27A probably damaging Het
Parp4 A T 14: 56,614,759 R799S possibly damaging Het
Pcdhga1 C A 18: 37,825,077 S826R probably damaging Het
Phldb1 T C 9: 44,696,135 R1258G probably damaging Het
Ppfia1 T C 7: 144,552,473 S21G probably benign Het
Ppp1r18 C A 17: 35,868,211 T326K probably damaging Het
Psg26 A G 7: 18,482,596 L106P probably damaging Het
Rabgap1l A T 1: 160,226,650 D265E probably benign Het
Rasgrp4 T C 7: 29,150,194 L554P possibly damaging Het
Rnf17 G T 14: 56,465,654 V621L probably benign Het
Sart3 T C 5: 113,745,602 K783R possibly damaging Het
Slc23a2 T A 2: 132,091,269 I90F probably damaging Het
Slc5a2 A T 7: 128,270,040 M331L probably damaging Het
Slc5a7 C G 17: 54,293,001 G128A probably damaging Het
Smcr8 A T 11: 60,780,354 Q776L probably damaging Het
Smpd4 T A 16: 17,640,971 D519E probably damaging Het
Smurf1 A T 5: 144,893,546 probably null Het
Spata18 T A 5: 73,659,293 N125K probably benign Het
Spice1 T A 16: 44,357,896 M94K probably damaging Het
Stard4 T C 18: 33,205,534 probably null Het
Stx17 A G 4: 48,140,442 D49G probably benign Het
Tbce T C 13: 14,019,795 D93G possibly damaging Het
Tbx21 T A 11: 97,098,893 D491V probably damaging Het
Tmbim4 G T 10: 120,208,826 probably benign Het
Tmem209 C T 6: 30,502,017 R62H probably damaging Het
Tmem237 A T 1: 59,119,612 probably null Het
Tmprss9 T C 10: 80,895,049 I803T probably benign Het
Trip4 C T 9: 65,885,010 A7T probably benign Het
Unc13a T C 8: 71,663,237 D107G probably benign Het
Uso1 C A 5: 92,192,740 Q672K possibly damaging Het
Washc2 T A 6: 116,219,988 N239K possibly damaging Het
Zfp661 A G 2: 127,577,120 C367R probably damaging Het
Znrf3 T A 11: 5,281,550 E558D probably damaging Het
Other mutations in Lrrc63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Lrrc63 APN 14 75084982 missense possibly damaging 0.73
IGL02222:Lrrc63 APN 14 75086140 missense probably damaging 0.99
IGL02385:Lrrc63 APN 14 75086200 missense probably benign
FR4548:Lrrc63 UTSW 14 75125182 small deletion probably benign
FR4589:Lrrc63 UTSW 14 75125182 small deletion probably benign
R0398:Lrrc63 UTSW 14 75126470 missense probably benign 0.06
R0637:Lrrc63 UTSW 14 75098220 splice site probably benign
R0669:Lrrc63 UTSW 14 75126110 missense probably benign 0.27
R1465:Lrrc63 UTSW 14 75107389 missense possibly damaging 0.92
R1465:Lrrc63 UTSW 14 75107389 missense possibly damaging 0.92
R1478:Lrrc63 UTSW 14 75125984 missense probably benign
R1591:Lrrc63 UTSW 14 75125892 missense possibly damaging 0.92
R1753:Lrrc63 UTSW 14 75086344 splice site probably null
R3713:Lrrc63 UTSW 14 75107336 missense probably benign 0.12
R4013:Lrrc63 UTSW 14 75098291 missense probably damaging 0.98
R4793:Lrrc63 UTSW 14 75126161 missense possibly damaging 0.93
R4888:Lrrc63 UTSW 14 75125966 missense probably benign
R4937:Lrrc63 UTSW 14 75084949 missense probably damaging 0.99
R5197:Lrrc63 UTSW 14 75084882 missense possibly damaging 0.68
R5747:Lrrc63 UTSW 14 75126464 missense probably benign
R5861:Lrrc63 UTSW 14 75107366 missense possibly damaging 0.83
R5905:Lrrc63 UTSW 14 75086174 missense possibly damaging 0.92
R6028:Lrrc63 UTSW 14 75086174 missense possibly damaging 0.92
R6661:Lrrc63 UTSW 14 75125193 missense unknown
R6982:Lrrc63 UTSW 14 75084771 missense probably benign 0.33
Z1088:Lrrc63 UTSW 14 75125990 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCGAACTGCATCTGGGATGTAATC -3'
(R):5'- CCCACAAATGCACCTCTTTG -3'

Sequencing Primer
(F):5'- GGGTCATTCCAGGAACT -3'
(R):5'- GCACCTCTTTGCATAATAAAATCGC -3'
Posted On2019-05-13