Incidental Mutation 'R7063:Zfp7'
ID548414
Institutional Source Beutler Lab
Gene Symbol Zfp7
Ensembl Gene ENSMUSG00000033669
Gene Namezinc finger protein 7
SynonymsKRAB20, Zfp-7, Zfp86-rs1, Zfp65, Zfp80, KRAB7, Krox-2, mszf73-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76879259-76892395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76891719 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 654 (I654V)
Ref Sequence ENSEMBL: ENSMUSP00000155599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023179] [ENSMUST00000229831] [ENSMUST00000229990] [ENSMUST00000230106] [ENSMUST00000230214]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023179
AA Change: I654V

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023179
Gene: ENSMUSG00000033669
AA Change: I654V

DomainStartEndE-ValueType
KRAB 4 65 3.07e-33 SMART
ZnF_C2H2 192 214 6.88e-4 SMART
ZnF_C2H2 220 242 4.24e-4 SMART
ZnF_C2H2 248 270 2.09e-3 SMART
ZnF_C2H2 276 298 1.45e-2 SMART
ZnF_C2H2 304 326 1.13e-4 SMART
ZnF_C2H2 332 354 9.08e-4 SMART
ZnF_C2H2 360 383 2.24e-3 SMART
ZnF_C2H2 412 434 9.08e-4 SMART
ZnF_C2H2 440 462 1.67e-2 SMART
ZnF_C2H2 468 490 3.44e-4 SMART
ZnF_C2H2 496 518 8.47e-4 SMART
ZnF_C2H2 524 546 4.54e-4 SMART
ZnF_C2H2 552 574 7.9e-4 SMART
ZnF_C2H2 580 602 1.72e-4 SMART
ZnF_C2H2 633 655 1.98e-4 SMART
ZnF_C2H2 661 683 4.79e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229831
Predicted Effect probably benign
Transcript: ENSMUST00000229990
Predicted Effect possibly damaging
Transcript: ENSMUST00000230106
AA Change: I654V

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000230214
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
C130060K24Rik A G 6: 65,441,403 probably benign Het
Casr T C 16: 36,494,574 I968V probably benign Het
Celf1 T C 2: 91,012,844 probably null Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 Y288C probably benign Het
Cyp2r1 A G 7: 114,552,949 S49P probably damaging Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Idh2 A G 7: 80,095,684 V403A probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Olfr958 T G 9: 39,550,115 Y252S possibly damaging Het
Pcmtd2 T A 2: 181,854,983 Y130* probably null Het
Rapgef5 A G 12: 117,689,129 D62G possibly damaging Het
Serpina3m A T 12: 104,391,467 I217L probably benign Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Sypl2 A T 3: 108,217,655 M130K probably benign Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vgll2 T C 10: 52,027,976 S312P probably benign Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in Zfp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Zfp7 APN 15 76890901 intron probably benign
IGL01509:Zfp7 APN 15 76881133 missense probably damaging 1.00
IGL01694:Zfp7 APN 15 76890795 nonsense probably null
IGL01731:Zfp7 APN 15 76888305 nonsense probably null
IGL02025:Zfp7 APN 15 76888264 missense probably damaging 1.00
R0841:Zfp7 UTSW 15 76891504 missense probably damaging 1.00
R1345:Zfp7 UTSW 15 76890708 missense probably damaging 1.00
R1625:Zfp7 UTSW 15 76881174 missense probably damaging 1.00
R1872:Zfp7 UTSW 15 76891777 missense probably benign 0.00
R2330:Zfp7 UTSW 15 76891309 missense probably damaging 1.00
R4170:Zfp7 UTSW 15 76891618 missense probably benign 0.00
R4795:Zfp7 UTSW 15 76891346 nonsense probably null
R4796:Zfp7 UTSW 15 76891346 nonsense probably null
R5038:Zfp7 UTSW 15 76891810 missense probably benign 0.01
R5277:Zfp7 UTSW 15 76881203 missense probably damaging 1.00
R5285:Zfp7 UTSW 15 76891222 missense probably damaging 1.00
R5287:Zfp7 UTSW 15 76891222 missense probably damaging 1.00
R5445:Zfp7 UTSW 15 76890854 nonsense probably null
R5655:Zfp7 UTSW 15 76891429 missense probably damaging 1.00
R6320:Zfp7 UTSW 15 76890610 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GAGCTCATACCTTATTGAACACC -3'
(R):5'- GGCTTCTGGCTTATTCATAGTTAC -3'

Sequencing Primer
(F):5'- TTGAACACCAGAGAATACACACTAG -3'
(R):5'- TCACGATGTGAGCTCTAAGC -3'
Posted On2019-05-13