Incidental Mutation 'R7065:Gk5'
ID548525
Institutional Source Beutler Lab
Gene Symbol Gk5
Ensembl Gene ENSMUSG00000041440
Gene Nameglycerol kinase 5 (putative)
SynonymsC330018K18Rik, G630067D24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7065 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location96119362-96184608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96179056 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 531 (Y531C)
Ref Sequence ENSEMBL: ENSMUSP00000082313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085217] [ENSMUST00000122383] [ENSMUST00000129774]
Predicted Effect probably damaging
Transcript: ENSMUST00000085217
AA Change: Y531C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082313
Gene: ENSMUSG00000041440
AA Change: Y531C

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 9e-50 PFAM
Pfam:FGGY_C 296 485 7.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122383
SMART Domains Protein: ENSMUSP00000112717
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 1.9e-49 PFAM
Pfam:FGGY_C 296 485 1.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129774
SMART Domains Protein: ENSMUSP00000123594
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
SCOP:d1bu6o1 24 56 1e-5 SMART
Meta Mutation Damage Score 0.392 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Homozygous knockout does not result in an obvious skin phenotype and does not lead to alopecia. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted(2) Gene trapped(17)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,298 D261G probably benign Het
Abca1 G T 4: 53,074,233 S1150Y probably damaging Het
Abca13 T A 11: 9,292,595 V1486E probably benign Het
Abca17 T A 17: 24,327,751 Y292F probably damaging Het
Adam3 A G 8: 24,711,675 probably null Het
Ankmy2 G A 12: 36,187,708 E269K probably damaging Het
Cdan1 A G 2: 120,718,921 S1201P probably benign Het
Cep57 T C 9: 13,818,381 Y122C probably damaging Het
Cfh T A 1: 140,086,402 Y1210F probably damaging Het
Cflar T G 1: 58,731,209 L154V probably damaging Het
Chmp4b A G 2: 154,691,242 D134G probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Ctnna1 A T 18: 35,152,616 H5L probably benign Het
Cyp2e1 T A 7: 140,763,993 L48Q probably damaging Het
Dnah6 T G 6: 73,087,562 Q2627P possibly damaging Het
Ehmt1 T C 2: 24,840,697 D569G probably damaging Het
Fam129a A G 1: 151,700,107 probably null Het
Frmd4a G A 2: 4,566,112 Het
Fryl T C 5: 73,090,756 D1006G probably damaging Het
Gclm A G 3: 122,262,671 N137D probably benign Het
Gpm6a C A 8: 55,037,458 N56K probably benign Het
Grik4 A C 9: 42,543,831 V656G probably damaging Het
Grip2 C A 6: 91,783,569 probably null Het
Gucy2c T C 6: 136,720,766 K636E probably damaging Het
Ifi44l A G 3: 151,759,792 I107T Het
Kif1b T C 4: 149,202,525 T1237A possibly damaging Het
Klk1b11 A G 7: 43,998,962 D131G probably benign Het
Lipe A G 7: 25,385,178 probably null Het
Lrp4 A G 2: 91,511,580 D1846G probably damaging Het
Madd A T 2: 91,155,057 M1273K probably benign Het
Matn3 T A 12: 8,952,472 M228K probably damaging Het
Mterf4 T A 1: 93,304,895 H78L probably benign Het
Ncoa4 T A 14: 32,172,900 L128* probably null Het
Nedd4l A G 18: 65,195,969 N627S probably benign Het
Nphp3 A G 9: 104,041,990 Y1279C probably damaging Het
Nrp1 C A 8: 128,460,712 T413N probably benign Het
Olfr1040 A C 2: 86,146,001 H244Q probably damaging Het
Olfr1205 A T 2: 88,831,386 I90F probably damaging Het
Olfr506 G A 7: 108,613,059 V251I probably damaging Het
Olfr994 A G 2: 85,430,179 Y217H probably damaging Het
Opn4 C A 14: 34,595,877 A267S probably benign Het
Pax3 T C 1: 78,194,011 probably null Het
Pcdha12 A G 18: 37,021,626 E466G probably damaging Het
Pdzk1 A G 3: 96,868,432 E372G probably benign Het
Pigs T A 11: 78,336,739 V243D possibly damaging Het
Pla2g5 C A 4: 138,800,604 C117F probably damaging Het
Ppt2 A G 17: 34,622,855 S236P probably damaging Het
Raver1 T C 9: 21,090,294 D81G probably benign Het
Rpgrip1 T C 14: 52,141,193 L525P possibly damaging Het
Ryr1 T C 7: 29,103,643 E662G probably damaging Het
Scaf8 G A 17: 3,159,211 V66M probably damaging Het
Scn3a A C 2: 65,464,855 L1508R probably benign Het
Slfn8 T C 11: 83,016,968 R250G probably benign Het
Speer4d A C 5: 15,620,423 T49P probably damaging Het
Spice1 T A 16: 44,355,535 D32E probably damaging Het
Stt3b A G 9: 115,266,156 L269P probably damaging Het
Ttn A G 2: 76,798,112 I14568T possibly damaging Het
U2surp T C 9: 95,485,659 T413A probably benign Het
Ubr3 A G 2: 69,953,705 E755G probably damaging Het
Unc5a A T 13: 54,991,083 S92C probably damaging Het
Zfat T C 15: 68,181,120 Y275C probably damaging Het
Zfp874a A T 13: 67,442,282 S428T probably damaging Het
Zfy1 A G Y: 725,428 V779A probably benign Het
Other mutations in Gk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Gk5 APN 9 96137789 missense probably damaging 0.98
IGL01387:Gk5 APN 9 96177554 critical splice donor site probably null
IGL01771:Gk5 APN 9 96177435 missense probably damaging 0.97
IGL02253:Gk5 APN 9 96137771 missense probably damaging 1.00
IGL02380:Gk5 APN 9 96150480 missense possibly damaging 0.92
IGL02566:Gk5 APN 9 96129046 missense possibly damaging 0.56
IGL03137:Gk5 APN 9 96176292 splice site probably benign
IGL03256:Gk5 APN 9 96129053 missense probably damaging 1.00
IGL03326:Gk5 APN 9 96137839 critical splice donor site probably null
barrener UTSW 9 96129096 critical splice donor site probably null
glimpse UTSW 9 96181770 critical splice acceptor site probably null
homer UTSW 9 96140656 nonsense probably null
sean UTSW 9 96176237 nonsense probably null
stripped UTSW 9 96129053 missense probably damaging 1.00
tangyuan UTSW 9 96150797 critical splice donor site probably null
toku UTSW 9 96140629 frame shift probably null
I1329:Gk5 UTSW 9 96140629 frame shift probably null
R0279:Gk5 UTSW 9 96174804 splice site probably benign
R0284:Gk5 UTSW 9 96181770 critical splice acceptor site probably null
R1134:Gk5 UTSW 9 96133407 missense probably benign 0.00
R1184:Gk5 UTSW 9 96150420 splice site probably benign
R1772:Gk5 UTSW 9 96150797 critical splice donor site probably null
R1781:Gk5 UTSW 9 96133455 missense possibly damaging 0.79
R3691:Gk5 UTSW 9 96129096 critical splice donor site probably null
R4213:Gk5 UTSW 9 96129053 missense probably damaging 1.00
R5015:Gk5 UTSW 9 96177417 critical splice acceptor site probably null
R5166:Gk5 UTSW 9 96174768 missense probably damaging 0.99
R5643:Gk5 UTSW 9 96140656 nonsense probably null
R5857:Gk5 UTSW 9 96119455 nonsense probably null
R5924:Gk5 UTSW 9 96150510 critical splice donor site probably null
R6109:Gk5 UTSW 9 96140610 missense probably benign 0.00
R6138:Gk5 UTSW 9 96176237 nonsense probably null
R6725:Gk5 UTSW 9 96155470 missense probably benign 0.01
R6812:Gk5 UTSW 9 96150749 missense probably damaging 0.99
R7182:Gk5 UTSW 9 96119526 missense possibly damaging 0.89
R7213:Gk5 UTSW 9 96145712 missense probably damaging 1.00
R7260:Gk5 UTSW 9 96119610 missense probably benign 0.10
U15987:Gk5 UTSW 9 96176237 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAGACATTTTACGAACCCGTTC -3'
(R):5'- CCTTTGGAAATCGCCAGAAG -3'

Sequencing Primer
(F):5'- GAACCCGTTCTTTGCCTTAAATTTTG -3'
(R):5'- GAGGTCTTGCTGCCTAAAAATTTCAC -3'
Posted On2019-05-13