Incidental Mutation 'R7066:Samd7'
ID548556
Institutional Source Beutler Lab
Gene Symbol Samd7
Ensembl Gene ENSMUSG00000051860
Gene Namesterile alpha motif domain containing 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R7066 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location30746293-30767174 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 30751123 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 18 (K18N)
Ref Sequence ENSEMBL: ENSMUSP00000133687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108262] [ENSMUST00000172593] [ENSMUST00000174395]
Predicted Effect probably benign
Transcript: ENSMUST00000108262
AA Change: K18N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103897
Gene: ENSMUSG00000051860
AA Change: K18N

DomainStartEndE-ValueType
SAM 321 388 2.12e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172593
AA Change: K18N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000174395
AA Change: K18N

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Homozygous knockout reduces the sensitivity of the retinal rods to low-to-moderate flash luminescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,927,114 V175A probably damaging Het
Adamts5 A T 16: 85,862,764 V880E probably damaging Het
Adgrf1 T A 17: 43,310,260 F463I probably benign Het
Ano1 T A 7: 144,637,086 E249D probably benign Het
Aoc1 A G 6: 48,908,619 D686G probably damaging Het
Cacna1d A T 14: 30,352,978 probably benign Het
Cdc42ep4 A G 11: 113,729,218 S116P probably damaging Het
Ces2a T C 8: 104,740,248 V463A probably damaging Het
Depdc5 A G 5: 32,901,848 D297G probably benign Het
Fsip2 T A 2: 82,990,891 V5656E possibly damaging Het
Gbp5 A G 3: 142,507,729 T469A probably benign Het
Gm21663 C G 5: 25,941,261 probably null Het
Iqch A G 9: 63,524,745 V456A probably benign Het
Lpcat1 A C 13: 73,511,381 I373L probably benign Het
Morc2b C T 17: 33,136,636 V721I probably benign Het
Mrgprb1 C T 7: 48,447,676 V163M probably benign Het
Mtfr2 A G 10: 20,354,226 I142V possibly damaging Het
Muc16 A T 9: 18,658,021 S1067R unknown Het
Myh14 T C 7: 44,630,755 S892G possibly damaging Het
Mylk2 C T 2: 152,911,668 probably null Het
Mzf1 A T 7: 13,043,563 V638E possibly damaging Het
Ncoa1 C T 12: 4,322,934 V156I possibly damaging Het
Nf1 A G 11: 79,556,720 E2450G probably damaging Het
Olfr1048 T C 2: 86,236,658 D52G probably damaging Het
Olfr1086 T A 2: 86,677,226 T36S possibly damaging Het
Olfr114 T A 17: 37,590,143 D70V probably damaging Het
Olfr1245 T C 2: 89,575,703 T8A probably damaging Het
Olfr1313 G A 2: 112,072,196 P129L probably damaging Het
Olfr389 A G 11: 73,777,192 I45T probably damaging Het
Olfr794 T C 10: 129,571,504 L283S probably damaging Het
Olfr969 A G 9: 39,796,124 I250V probably benign Het
P4htm T G 9: 108,596,963 K125N probably damaging Het
Patj A G 4: 98,413,197 T240A probably benign Het
Pcolce2 T C 9: 95,681,621 V220A probably benign Het
Pcyox1 A T 6: 86,394,496 I136N probably damaging Het
Pde4b A G 4: 102,602,806 S395G probably benign Het
Peg3 C A 7: 6,708,857 R1122L probably damaging Het
Plekhm1 A G 11: 103,370,988 V922A possibly damaging Het
Rad51c T C 11: 87,402,676 N118S possibly damaging Het
Rb1cc1 T A 1: 6,250,005 V1216D possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rlf T C 4: 121,148,787 M999V probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Sema5b A C 16: 35,651,312 D425A probably benign Het
Siglecg A G 7: 43,411,742 E413G probably benign Het
Tcaf1 A T 6: 42,679,177 N288K probably damaging Het
Tdp1 A G 12: 99,894,732 D210G probably benign Het
Umps A T 16: 33,961,733 L273* probably null Het
Vcan A T 13: 89,705,686 V385D probably damaging Het
Wdr59 T C 8: 111,465,845 T676A probably benign Het
Zdbf2 A G 1: 63,307,559 H1699R probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Samd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Samd7 APN 3 30765250 missense probably damaging 1.00
IGL01813:Samd7 APN 3 30754286 missense probably benign 0.00
IGL02884:Samd7 APN 3 30756173 missense probably damaging 1.00
IGL03018:Samd7 APN 3 30762145 missense probably damaging 1.00
IGL03263:Samd7 APN 3 30762153 missense probably damaging 1.00
R0244:Samd7 UTSW 3 30751073 missense probably benign 0.41
R0638:Samd7 UTSW 3 30756521 missense probably benign 0.01
R1490:Samd7 UTSW 3 30758353 missense probably benign 0.01
R2099:Samd7 UTSW 3 30756560 missense probably benign 0.00
R3725:Samd7 UTSW 3 30751134 missense possibly damaging 0.46
R5557:Samd7 UTSW 3 30756620 missense probably benign 0.21
R5899:Samd7 UTSW 3 30756734 missense probably benign 0.00
R6088:Samd7 UTSW 3 30756483 missense probably benign 0.00
R6985:Samd7 UTSW 3 30751123 missense probably benign 0.02
R7067:Samd7 UTSW 3 30751123 missense probably benign 0.02
R7073:Samd7 UTSW 3 30756482 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GAGGAACAACACCCATGTGC -3'
(R):5'- GGTAAGACCAGCAGAGTACC -3'

Sequencing Primer
(F):5'- TGTGCTTTACCTAAACAGGCAC -3'
(R):5'- CAGAGTACCATGAGTCACGGC -3'
Posted On2019-05-13