Incidental Mutation 'R7067:Golga1'
ID548605
Institutional Source Beutler Lab
Gene Symbol Golga1
Ensembl Gene ENSMUSG00000026754
Gene Namegolgi autoantigen, golgin subfamily a, 1
Synonyms0710001G09Rik, Golgi97, golgin-97, 2210418B03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location39016155-39065541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39047719 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 104 (D104E)
Ref Sequence ENSEMBL: ENSMUSP00000145206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039165] [ENSMUST00000112850] [ENSMUST00000149810] [ENSMUST00000184996]
Predicted Effect probably benign
Transcript: ENSMUST00000039165
AA Change: D203E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037735
Gene: ENSMUSG00000026754
AA Change: D203E

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112850
AA Change: D178E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108471
Gene: ENSMUSG00000026754
AA Change: D178E

DomainStartEndE-ValueType
coiled coil region 53 144 N/A INTRINSIC
coiled coil region 165 530 N/A INTRINSIC
coiled coil region 574 622 N/A INTRINSIC
Grip 657 703 5.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149810
AA Change: D104E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145206
Gene: ENSMUSG00000026754
AA Change: D104E

DomainStartEndE-ValueType
coiled coil region 1 48 N/A INTRINSIC
coiled coil region 70 183 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000184996
AA Change: D203E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139001
Gene: ENSMUSG00000026754
AA Change: D203E

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein is associated with Sjogren's syndrome. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice exhibit tremors and limb grasping behavior at two months of age. A variable severity of hearing loss was also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Golga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Golga1 APN 2 39052973 nonsense probably null
IGL00949:Golga1 APN 2 39041255 missense probably damaging 0.98
IGL01133:Golga1 APN 2 39023472 missense probably benign
IGL01592:Golga1 APN 2 39063282 missense probably damaging 1.00
IGL01613:Golga1 APN 2 39020126 missense probably benign 0.14
IGL01819:Golga1 APN 2 39034149 missense probably benign 0.00
IGL01871:Golga1 APN 2 39050198 splice site probably benign
IGL02744:Golga1 APN 2 39018474 missense probably damaging 1.00
IGL02819:Golga1 APN 2 39039078 missense probably null 0.97
IGL02874:Golga1 APN 2 39039092 missense probably damaging 1.00
R0167:Golga1 UTSW 2 39047648 missense probably benign 0.00
R0245:Golga1 UTSW 2 39035259 missense probably benign 0.00
R0389:Golga1 UTSW 2 39018441 missense probably damaging 1.00
R0443:Golga1 UTSW 2 39018441 missense probably damaging 1.00
R0906:Golga1 UTSW 2 39047643 missense probably damaging 0.99
R1508:Golga1 UTSW 2 39023249 missense probably benign
R1901:Golga1 UTSW 2 39047780 splice site probably null
R1964:Golga1 UTSW 2 39047087 missense probably benign 0.00
R2228:Golga1 UTSW 2 39023171 missense probably benign 0.02
R3734:Golga1 UTSW 2 39050170 missense possibly damaging 0.88
R4407:Golga1 UTSW 2 39019641 unclassified probably null
R4504:Golga1 UTSW 2 39023454 missense probably benign 0.00
R4973:Golga1 UTSW 2 39039106 missense probably damaging 0.99
R5049:Golga1 UTSW 2 39047735 missense probably damaging 1.00
R5600:Golga1 UTSW 2 39020099 missense probably damaging 1.00
R6008:Golga1 UTSW 2 39047087 missense probably benign 0.00
R6374:Golga1 UTSW 2 39034068 missense probably benign
R6388:Golga1 UTSW 2 39023171 missense probably benign 0.02
R6601:Golga1 UTSW 2 39020106 missense probably damaging 1.00
X0025:Golga1 UTSW 2 39052062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTTTAGCAATGCTACACC -3'
(R):5'- GCCTAATTCTCATCCCACAAATATGTC -3'

Sequencing Primer
(F):5'- GCTTTAGCAATGCTACACCAACAC -3'
(R):5'- TCCTTACAGCATGGAATCCAGGG -3'
Posted On2019-05-13