Incidental Mutation 'R7067:Pole'
ID548621
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Namepolymerase (DNA directed), epsilon
Synonymspol-epsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location110286306-110337474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110334218 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 142 (G142V)
Ref Sequence ENSEMBL: ENSMUSP00000108100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296] [ENSMUST00000112481]
Predicted Effect probably benign
Transcript: ENSMUST00000007296
AA Change: G2018V

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: G2018V

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112481
AA Change: G142V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108100
Gene: ENSMUSG00000007080
AA Change: G142V

DomainStartEndE-ValueType
Pfam:DUF1744 13 48 2.7e-13 PFAM
coiled coil region 60 87 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110303565 splice site probably benign
IGL00475:Pole APN 5 110291096 nonsense probably null
IGL00837:Pole APN 5 110302009 missense possibly damaging 0.91
IGL00976:Pole APN 5 110323572 missense probably benign 0.00
IGL01081:Pole APN 5 110337240 missense possibly damaging 0.92
IGL01503:Pole APN 5 110303884 missense probably damaging 1.00
IGL01640:Pole APN 5 110298266 missense probably null 0.08
IGL01987:Pole APN 5 110337232 missense probably benign 0.01
IGL02429:Pole APN 5 110299800 missense probably benign
IGL02733:Pole APN 5 110312728 splice site probably benign
IGL03102:Pole APN 5 110297073 missense probably damaging 1.00
IGL03157:Pole APN 5 110293753 missense probably benign
IGL03186:Pole APN 5 110299920 critical splice donor site probably null
IGL03271:Pole APN 5 110318319 missense probably benign
IGL03351:Pole APN 5 110301998 splice site probably benign
IGL03408:Pole APN 5 110294560 missense probably damaging 1.00
IGL03410:Pole APN 5 110324559 missense probably benign
ANU74:Pole UTSW 5 110289370 missense probably benign 0.44
PIT4495001:Pole UTSW 5 110303914 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0124:Pole UTSW 5 110303992 missense probably damaging 0.96
R0145:Pole UTSW 5 110324425 missense probably damaging 0.99
R0523:Pole UTSW 5 110303593 missense probably damaging 0.96
R0590:Pole UTSW 5 110317926 missense probably benign
R0625:Pole UTSW 5 110325550 missense possibly damaging 0.50
R0707:Pole UTSW 5 110298988 missense probably damaging 1.00
R1160:Pole UTSW 5 110295253 missense possibly damaging 0.85
R1320:Pole UTSW 5 110309129 frame shift probably null
R1384:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1626:Pole UTSW 5 110293369 missense probably benign 0.25
R1643:Pole UTSW 5 110317845 missense probably damaging 1.00
R1655:Pole UTSW 5 110335922 missense probably damaging 1.00
R1668:Pole UTSW 5 110297369 missense probably damaging 1.00
R1783:Pole UTSW 5 110297430 missense probably damaging 1.00
R1843:Pole UTSW 5 110330835 critical splice donor site probably null
R1853:Pole UTSW 5 110306853 missense possibly damaging 0.95
R1867:Pole UTSW 5 110334197 missense probably benign 0.08
R1874:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1891:Pole UTSW 5 110332542 missense probably damaging 1.00
R1928:Pole UTSW 5 110327778 missense probably benign
R2073:Pole UTSW 5 110325551 missense probably damaging 0.99
R2341:Pole UTSW 5 110330963 missense possibly damaging 0.67
R2448:Pole UTSW 5 110297092 missense probably damaging 1.00
R2504:Pole UTSW 5 110290502 splice site probably null
R3053:Pole UTSW 5 110289795 missense probably damaging 1.00
R3892:Pole UTSW 5 110336439 missense probably damaging 1.00
R3964:Pole UTSW 5 110312782 missense probably damaging 1.00
R3965:Pole UTSW 5 110312782 missense probably damaging 1.00
R4374:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4376:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4377:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4520:Pole UTSW 5 110297924 missense probably damaging 1.00
R4670:Pole UTSW 5 110306387 missense probably benign 0.01
R4778:Pole UTSW 5 110330832 missense probably benign 0.00
R4887:Pole UTSW 5 110324753 missense probably damaging 0.99
R4898:Pole UTSW 5 110290224 critical splice acceptor site probably null
R5184:Pole UTSW 5 110294934 missense possibly damaging 0.91
R5359:Pole UTSW 5 110332488 missense probably benign 0.03
R5483:Pole UTSW 5 110294568 missense probably damaging 1.00
R5529:Pole UTSW 5 110332466 missense probably benign 0.20
R5576:Pole UTSW 5 110312065 nonsense probably null
R5817:Pole UTSW 5 110312972 missense probably damaging 1.00
R5877:Pole UTSW 5 110332463 missense probably benign
R5956:Pole UTSW 5 110337287 unclassified probably benign
R5990:Pole UTSW 5 110302144 missense probably damaging 1.00
R6019:Pole UTSW 5 110324514 missense probably benign 0.01
R6019:Pole UTSW 5 110324515 missense probably benign 0.01
R6093:Pole UTSW 5 110312090 missense probably benign 0.01
R6376:Pole UTSW 5 110336374 missense probably damaging 0.99
R6494:Pole UTSW 5 110324722 missense possibly damaging 0.86
R6535:Pole UTSW 5 110324807 missense probably damaging 1.00
R6723:Pole UTSW 5 110323616 missense probably benign 0.11
R6757:Pole UTSW 5 110303610 missense probably damaging 1.00
R6930:Pole UTSW 5 110293290 missense probably benign 0.01
R6988:Pole UTSW 5 110329583 missense probably damaging 0.97
R6992:Pole UTSW 5 110332499 missense probably damaging 0.99
R7097:Pole UTSW 5 110325102 synonymous probably null
R7122:Pole UTSW 5 110325102 synonymous probably null
R7202:Pole UTSW 5 110297107 missense possibly damaging 0.94
R7340:Pole UTSW 5 110334464 missense probably benign 0.06
R7345:Pole UTSW 5 110303903 missense possibly damaging 0.82
X0064:Pole UTSW 5 110317904 nonsense probably null
Y5377:Pole UTSW 5 110294891 critical splice acceptor site probably null
Y5380:Pole UTSW 5 110294891 critical splice acceptor site probably null
Z1088:Pole UTSW 5 110327865 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TCAAAGGGCAACAGCTAAGC -3'
(R):5'- GTGATCATTCCTGGGAAGGAG -3'

Sequencing Primer
(F):5'- GCTGTTGCTAACAATGACATTTC -3'
(R):5'- TGCTAAGGGACAGACTCAGCTG -3'
Posted On2019-05-13