Incidental Mutation 'R7067:Repin1'
ID548623
Institutional Source Beutler Lab
Gene Symbol Repin1
Ensembl Gene ENSMUSG00000052751
Gene Namereplication initiator 1
SynonymsZfp464, E430037F08Rik, AP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48593883-48599082 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 48597916 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 537 (L537*)
Ref Sequence ENSEMBL: ENSMUSP00000132365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009420] [ENSMUST00000118229] [ENSMUST00000135151] [ENSMUST00000154010] [ENSMUST00000163452] [ENSMUST00000204095] [ENSMUST00000204121] [ENSMUST00000204521]
Predicted Effect probably null
Transcript: ENSMUST00000009420
AA Change: L537*
SMART Domains Protein: ENSMUSP00000009420
Gene: ENSMUSG00000052751
AA Change: L537*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118229
AA Change: L590*
SMART Domains Protein: ENSMUSP00000113548
Gene: ENSMUSG00000052751
AA Change: L590*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135151
AA Change: L593*
SMART Domains Protein: ENSMUSP00000118890
Gene: ENSMUSG00000052751
AA Change: L593*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
Pfam:zf-C2H2_6 284 300 1.4e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154010
SMART Domains Protein: ENSMUSP00000121975
Gene: ENSMUSG00000052751

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163452
AA Change: L537*
SMART Domains Protein: ENSMUSP00000132365
Gene: ENSMUSG00000052751
AA Change: L537*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204095
SMART Domains Protein: ENSMUSP00000145192
Gene: ENSMUSG00000007216

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
ZnF_C2H2 104 126 7.9e-4 SMART
ZnF_C2H2 132 154 1.69e-3 SMART
ZnF_C2H2 160 182 2.36e-2 SMART
ZnF_C2H2 188 210 4.11e-2 SMART
ZnF_C2H2 279 301 1.84e-4 SMART
ZnF_C2H2 307 329 4.94e-5 SMART
ZnF_C2H2 335 357 2.95e-3 SMART
ZnF_C2H2 364 386 1.36e-2 SMART
ZnF_C2H2 446 468 1.3e-4 SMART
ZnF_C2H2 474 496 2.12e-4 SMART
ZnF_C2H2 502 524 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204121
Predicted Effect probably benign
Transcript: ENSMUST00000204521
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele improves in insulin sensitivity and glucose metabolism in Leprdb homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Repin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Repin1 APN 6 48596905 missense probably damaging 1.00
IGL01103:Repin1 APN 6 48597953 intron probably benign
IGL02027:Repin1 APN 6 48596473 missense probably damaging 1.00
IGL02143:Repin1 APN 6 48597121 missense probably damaging 1.00
R0395:Repin1 UTSW 6 48597525 missense probably damaging 1.00
R1233:Repin1 UTSW 6 48597834 missense possibly damaging 0.72
R1743:Repin1 UTSW 6 48597750 missense probably damaging 0.96
R2259:Repin1 UTSW 6 48596530 missense probably benign 0.00
R4509:Repin1 UTSW 6 48596526 missense possibly damaging 0.77
R5008:Repin1 UTSW 6 48596608 missense probably damaging 1.00
R5009:Repin1 UTSW 6 48594845 intron probably benign
R5425:Repin1 UTSW 6 48596431 missense probably benign 0.18
R5829:Repin1 UTSW 6 48594832 intron probably benign
R6350:Repin1 UTSW 6 48597628 missense probably damaging 0.98
R6841:Repin1 UTSW 6 48597925 missense possibly damaging 0.95
R6854:Repin1 UTSW 6 48593891 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCAGTCAGAAGTCCAACCTGG -3'
(R):5'- TGGGTTCCCTGGATACCTAG -3'

Sequencing Primer
(F):5'- TCAGAAGTCCAACCTGGTGTCC -3'
(R):5'- TTCCCTGGATACCTAGGGGAAAGTC -3'
Posted On2019-05-13