Incidental Mutation 'R7067:Zfp383'
ID548628
Institutional Source Beutler Lab
Gene Symbol Zfp383
Ensembl Gene ENSMUSG00000099689
Gene Namezinc finger protein 383
Synonyms1110003H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29908223-29916813 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 29908646 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000141019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053521] [ENSMUST00000159920] [ENSMUST00000162592] [ENSMUST00000186475] [ENSMUST00000187028]
Predicted Effect probably benign
Transcript: ENSMUST00000053521
SMART Domains Protein: ENSMUSP00000054012
Gene: ENSMUSG00000062040

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159920
SMART Domains Protein: ENSMUSP00000125232
Gene: ENSMUSG00000062040

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162592
SMART Domains Protein: ENSMUSP00000123953
Gene: ENSMUSG00000062040

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000186475
AA Change: M1K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140742
Gene: ENSMUSG00000099689
AA Change: M1K

DomainStartEndE-ValueType
KRAB 27 87 4.95e-37 SMART
low complexity region 165 173 N/A INTRINSIC
ZnF_C2H2 185 207 1.47e-3 SMART
ZnF_C2H2 213 235 7.15e-2 SMART
ZnF_C2H2 241 263 1.79e-2 SMART
ZnF_C2H2 269 291 4.17e-3 SMART
ZnF_C2H2 297 319 3.69e-4 SMART
ZnF_C2H2 325 347 2.27e-4 SMART
ZnF_C2H2 353 375 1.84e-4 SMART
ZnF_C2H2 381 403 6.52e-5 SMART
ZnF_C2H2 409 431 1.58e-3 SMART
ZnF_C2H2 437 459 1.69e-3 SMART
ZnF_C2H2 465 487 1.82e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000187028
AA Change: M1K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000141019
Gene: ENSMUSG00000099689
AA Change: M1K

DomainStartEndE-ValueType
KRAB 27 87 5.6e-22 SMART
low complexity region 124 142 N/A INTRINSIC
Meta Mutation Damage Score 0.58 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a KRAB-related zinc finger protein that inhibits the transcription of some MAPK signaling pathway genes. The repressor activity resides in the KRAB domain of the encoded protein. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Zfp383
AlleleSourceChrCoordTypePredicted EffectPPH Score
flyer UTSW 7 29914727 missense probably benign
R4796:Zfp383 UTSW 7 29914838 missense possibly damaging 0.72
R5114:Zfp383 UTSW 7 29914741 missense probably damaging 1.00
R5372:Zfp383 UTSW 7 29915270 nonsense probably null
R5622:Zfp383 UTSW 7 29912190 missense probably damaging 1.00
R5963:Zfp383 UTSW 7 29915678 missense possibly damaging 0.84
R6639:Zfp383 UTSW 7 29914727 missense probably benign
R6952:Zfp383 UTSW 7 29914955 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGCGGACTACATTTCCCAG -3'
(R):5'- TACCGTTACACACAATAGGTCC -3'

Sequencing Primer
(F):5'- GGACTACATTTCCCAGAAGCGTTC -3'
(R):5'- TTGGGACACAATCACACACACTG -3'
Posted On2019-05-13