Incidental Mutation 'R7067:Aebp1'
ID548643
Institutional Source Beutler Lab
Gene Symbol Aebp1
Ensembl Gene ENSMUSG00000020473
Gene NameAE binding protein 1
SynonymsACLP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location5861947-5872088 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 5866431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102923] [ENSMUST00000109829]
Predicted Effect probably null
Transcript: ENSMUST00000102923
SMART Domains Protein: ENSMUSP00000099987
Gene: ENSMUSG00000020473

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 46 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
low complexity region 113 159 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
low complexity region 264 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
FA58C 375 531 8.72e-46 SMART
Zn_pept 555 983 5.56e-43 SMART
low complexity region 1005 1029 N/A INTRINSIC
low complexity region 1035 1052 N/A INTRINSIC
low complexity region 1069 1089 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109829
SMART Domains Protein: ENSMUSP00000105454
Gene: ENSMUSG00000020473

DomainStartEndE-ValueType
FA58C 1 151 2.04e-37 SMART
Zn_pept 175 603 5.56e-43 SMART
low complexity region 625 649 N/A INTRINSIC
low complexity region 655 672 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of carboxypeptidase A protein family. The encoded protein may function as a transcriptional repressor and play a role in adipogenesis and smooth muscle cell differentiation. Studies in mice suggest that this gene functions in wound healing and abdominal wall development. Overexpression of this gene is associated with glioblastoma. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for one null allele exhibit neonatal lethality, abdominal wall herniation, extrusion of the abdominal organs, and defects in wound healing. Mice homozygous for another null allele exhibit embryonic lethality, decreased white adipose tissue, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Aebp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Aebp1 APN 11 5871787 missense possibly damaging 0.67
IGL01464:Aebp1 APN 11 5869822 missense possibly damaging 0.46
IGL01561:Aebp1 APN 11 5871349 missense probably damaging 1.00
IGL01648:Aebp1 APN 11 5870607 missense possibly damaging 0.96
IGL01950:Aebp1 APN 11 5869108 missense probably benign 0.02
IGL02094:Aebp1 APN 11 5868357 missense probably benign 0.17
IGL02585:Aebp1 APN 11 5870855 splice site probably null
R0006:Aebp1 UTSW 11 5863935 unclassified probably benign
R0551:Aebp1 UTSW 11 5867955 missense probably benign 0.04
R1144:Aebp1 UTSW 11 5868475 missense probably benign 0.17
R1265:Aebp1 UTSW 11 5871740 missense probably damaging 0.98
R1297:Aebp1 UTSW 11 5870834 missense possibly damaging 0.69
R1518:Aebp1 UTSW 11 5871469 missense possibly damaging 0.58
R1524:Aebp1 UTSW 11 5870089 missense probably damaging 0.98
R2567:Aebp1 UTSW 11 5870251 missense probably benign 0.29
R3155:Aebp1 UTSW 11 5871425 missense probably benign 0.16
R4415:Aebp1 UTSW 11 5865451 missense probably damaging 0.96
R4507:Aebp1 UTSW 11 5870565 missense probably damaging 1.00
R5248:Aebp1 UTSW 11 5868501 missense possibly damaging 0.63
R5597:Aebp1 UTSW 11 5866487 missense probably benign 0.01
R5809:Aebp1 UTSW 11 5870257 missense probably benign
R5919:Aebp1 UTSW 11 5871421 missense probably benign 0.00
R5982:Aebp1 UTSW 11 5867911 missense possibly damaging 0.69
R6139:Aebp1 UTSW 11 5871842 missense probably damaging 1.00
R7289:Aebp1 UTSW 11 5865059 missense probably damaging 1.00
R7383:Aebp1 UTSW 11 5868548 missense probably damaging 1.00
R7437:Aebp1 UTSW 11 5869757 missense possibly damaging 0.50
Z1088:Aebp1 UTSW 11 5871460 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAAATGGTAGCTGCCACC -3'
(R):5'- CATGCAGATAAGGATCAGGCTG -3'

Sequencing Primer
(F):5'- ACCCAGGCACCTGTCTTG -3'
(R):5'- TCAGGCTGAGCAGGGGAC -3'
Posted On2019-05-13