Incidental Mutation 'R7067:Efemp1'
ID548645
Institutional Source Beutler Lab
Gene Symbol Efemp1
Ensembl Gene ENSMUSG00000020467
Gene Nameepidermal growth factor-containing fibulin-like extracellular matrix protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location28853204-28926743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28867926 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 135 (N135I)
Ref Sequence ENSEMBL: ENSMUSP00000020759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020759]
Predicted Effect probably damaging
Transcript: ENSMUST00000020759
AA Change: N135I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020759
Gene: ENSMUSG00000020467
AA Change: N135I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EGF_like 44 76 9.53e-2 SMART
low complexity region 87 104 N/A INTRINSIC
EGF_CA 173 213 5.78e-11 SMART
EGF_CA 214 253 2.35e-11 SMART
EGF_CA 254 293 1.22e-9 SMART
EGF_CA 294 333 1.35e-11 SMART
EGF_like 334 378 3.49e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibulin family of extracellular matrix glycoproteins. Like all members of this family, the encoded protein contains tandemly repeated epidermal growth factor-like repeats followed by a C-terminus fibulin-type domain. This gene is upregulated in malignant gliomas and may play a role in the aggressive nature of these tumors. Mutations in this gene are associated with Doyne honeycomb retinal dystrophy. Alternatively spliced transcript variants that encode the same protein have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. Mice homozygous for a single amino acid substitution develop deposits below the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Efemp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Efemp1 APN 11 28926223 missense probably benign 0.32
IGL01862:Efemp1 APN 11 28921428 missense probably damaging 0.97
IGL02568:Efemp1 APN 11 28916971 critical splice donor site probably null
IGL03175:Efemp1 APN 11 28926259 missense probably benign 0.04
IGL03014:Efemp1 UTSW 11 28926218 missense probably damaging 0.96
R0973:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R0973:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R0974:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R1678:Efemp1 UTSW 11 28916942 missense probably benign 0.00
R1701:Efemp1 UTSW 11 28921750 missense possibly damaging 0.68
R1831:Efemp1 UTSW 11 28921442 missense possibly damaging 0.91
R2016:Efemp1 UTSW 11 28921613 missense probably damaging 1.00
R2017:Efemp1 UTSW 11 28921613 missense probably damaging 1.00
R2024:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2025:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2027:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2084:Efemp1 UTSW 11 28915763 missense probably damaging 1.00
R2396:Efemp1 UTSW 11 28867941 missense possibly damaging 0.83
R4803:Efemp1 UTSW 11 28921795 missense possibly damaging 0.84
R4817:Efemp1 UTSW 11 28926241 missense probably damaging 1.00
R5201:Efemp1 UTSW 11 28914590 missense probably benign 0.05
R5297:Efemp1 UTSW 11 28867868 missense probably damaging 0.99
R5534:Efemp1 UTSW 11 28867758 missense probably damaging 1.00
R5839:Efemp1 UTSW 11 28921418 missense possibly damaging 0.95
R6037:Efemp1 UTSW 11 28921760 missense probably damaging 1.00
R6037:Efemp1 UTSW 11 28921760 missense probably damaging 1.00
R6314:Efemp1 UTSW 11 28914603 missense probably benign 0.12
R7396:Efemp1 UTSW 11 28867501 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGAGGATATCTCTGCCTTCC -3'
(R):5'- AGCTCTGTCCTTAACACCTGTATG -3'

Sequencing Primer
(F):5'- GGAGGATATCTCTGCCTTCCTAAAAC -3'
(R):5'- ACTTGGCTGGATACTCGAAC -3'
Posted On2019-05-13