Incidental Mutation 'R7067:Tlx3'
ID548646
Institutional Source Beutler Lab
Gene Symbol Tlx3
Ensembl Gene ENSMUSG00000040610
Gene NameT cell leukemia, homeobox 3
SynonymsHox11l2, Rnx, Tlx1l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location33200752-33203589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33203204 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 86 (G86S)
Ref Sequence ENSEMBL: ENSMUSP00000047457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037746]
Predicted Effect probably damaging
Transcript: ENSMUST00000037746
AA Change: G86S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047457
Gene: ENSMUSG00000040610
AA Change: G86S

DomainStartEndE-ValueType
low complexity region 45 53 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
HOX 166 228 1.37e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan homeobox protein that encodes a DNA-binding nuclear transcription factor. A translocation [t(5;14)(q35;q32)] involving this gene is associated with T-cell acute lymphoblastic leukemia (T-ALL) in children and young adults. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice die within 1 day of birth due to a central respiratory failure that resembles human congenital central hypoventilation syndrome. Mice homozygous for an ENU-induced allele exhibit uncoordinated movements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Tlx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0866:Tlx3 UTSW 11 33203315 missense probably damaging 0.99
R1899:Tlx3 UTSW 11 33203072 missense probably benign 0.30
R6228:Tlx3 UTSW 11 33202432 missense probably benign 0.13
R6342:Tlx3 UTSW 11 33202567 missense possibly damaging 0.67
R7290:Tlx3 UTSW 11 33203514 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCTGTGAAGCGGTCCTTTAC -3'
(R):5'- AAAGTTTCAGTGCGACTGGAG -3'

Sequencing Primer
(F):5'- CTGTGAAGCGGTCCTTTACAAAGC -3'
(R):5'- ATCAGCTTCGGCATCGAC -3'
Posted On2019-05-13