Incidental Mutation 'R7067:Vars'
ID548656
Institutional Source Beutler Lab
Gene Symbol Vars
Ensembl Gene ENSMUSG00000007029
Gene Namevalyl-tRNA synthetase
SynonymsBat-6, Bat6, G7a, D17H6S56E, Vars2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35000987-35016322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35011479 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 513 (V513I)
Ref Sequence ENSEMBL: ENSMUSP00000133994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087315] [ENSMUST00000173584]
Predicted Effect probably damaging
Transcript: ENSMUST00000087315
AA Change: V513I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084572
Gene: ENSMUSG00000007029
AA Change: V513I

DomainStartEndE-ValueType
Pfam:GST_N 2 81 5.7e-16 PFAM
Pfam:GST_C 107 198 7.3e-13 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 2e-197 PFAM
Pfam:tRNA-synt_1g 336 496 6e-6 PFAM
Pfam:tRNA-synt_1_2 555 623 1.9e-11 PFAM
Pfam:Anticodon_1 983 1138 2.6e-34 PFAM
low complexity region 1153 1174 N/A INTRINSIC
low complexity region 1207 1225 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173142
SMART Domains Protein: ENSMUSP00000134669
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
SCOP:d1gaxa3 32 67 3e-7 SMART
PDB:1IYW|B 36 122 4e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000173584
AA Change: V513I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133994
Gene: ENSMUSG00000007029
AA Change: V513I

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
Pfam:GST_C 96 198 7.8e-14 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 1.9e-200 PFAM
Pfam:tRNA-synt_1g 336 493 2.1e-7 PFAM
Pfam:tRNA-synt_1_2 555 623 1.1e-12 PFAM
Pfam:Anticodon_1 983 1138 7.2e-36 PFAM
low complexity region 1153 1174 N/A INTRINSIC
coiled coil region 1197 1225 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. The protein encoded by this gene belongs to class-I aminoacyl-tRNA synthetase family and is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Vars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Vars APN 17 35013873 missense probably benign 0.00
IGL02160:Vars APN 17 35001502 missense probably damaging 1.00
IGL02303:Vars APN 17 35015484 splice site probably benign
IGL03027:Vars APN 17 35013687 missense probably damaging 1.00
maladroit UTSW 17 35005475 missense probably benign 0.30
whoops UTSW 17 35013644 missense probably damaging 1.00
FR4304:Vars UTSW 17 35015989 small insertion probably benign
FR4548:Vars UTSW 17 35015989 small insertion probably benign
FR4548:Vars UTSW 17 35015991 small insertion probably benign
FR4589:Vars UTSW 17 35015988 small insertion probably benign
R0045:Vars UTSW 17 35010619 missense probably damaging 1.00
R0045:Vars UTSW 17 34998066 missense probably benign 0.13
R0045:Vars UTSW 17 35010619 missense probably damaging 1.00
R0266:Vars UTSW 17 35013869 missense probably benign 0.00
R0267:Vars UTSW 17 35011596 splice site probably benign
R0391:Vars UTSW 17 35011486 missense possibly damaging 0.79
R0445:Vars UTSW 17 35011809 missense probably benign 0.31
R0449:Vars UTSW 17 35012727 splice site probably null
R0557:Vars UTSW 17 35004984 missense possibly damaging 0.90
R0559:Vars UTSW 17 35014058 nonsense probably null
R0730:Vars UTSW 17 35014300 missense probably damaging 1.00
R0748:Vars UTSW 17 34998012 missense probably damaging 1.00
R1692:Vars UTSW 17 35013725 missense probably damaging 1.00
R1693:Vars UTSW 17 34998196 missense probably benign 0.31
R1697:Vars UTSW 17 34998222 missense probably benign 0.43
R1699:Vars UTSW 17 35014758 missense possibly damaging 0.93
R1712:Vars UTSW 17 35014752 missense probably damaging 1.00
R1989:Vars UTSW 17 35011838 missense possibly damaging 0.94
R2349:Vars UTSW 17 35015752 missense probably benign
R2365:Vars UTSW 17 35015452 missense probably benign 0.01
R3790:Vars UTSW 17 34999334 missense probably benign 0.34
R4615:Vars UTSW 17 35013881 missense probably damaging 0.97
R4844:Vars UTSW 17 35011612 missense probably damaging 1.00
R4856:Vars UTSW 17 35015726 missense probably benign 0.37
R4886:Vars UTSW 17 35015726 missense probably benign 0.37
R5570:Vars UTSW 17 35016238 missense probably benign 0.04
R5706:Vars UTSW 17 35005481 unclassified probably null
R5858:Vars UTSW 17 35005475 missense probably benign 0.30
R5907:Vars UTSW 17 35012376 missense probably damaging 1.00
R5917:Vars UTSW 17 35012515 missense probably damaging 0.99
R5944:Vars UTSW 17 35013644 missense probably damaging 1.00
R6023:Vars UTSW 17 35001609 missense probably damaging 1.00
R6073:Vars UTSW 17 35001529 missense probably benign
R6273:Vars UTSW 17 35013743 missense probably damaging 1.00
R6390:Vars UTSW 17 35015639 missense probably benign 0.00
R6658:Vars UTSW 17 35015741 missense probably benign 0.03
R7387:Vars UTSW 17 35004792 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAGGCTCCACGAAGAAGGG -3'
(R):5'- CATGGTCTCAATCCGGGTTG -3'

Sequencing Primer
(F):5'- TCCACGAAGAAGGGGTCATCTAC -3'
(R):5'- AATCCGGGTTGTTGCCAC -3'
Posted On2019-05-13