Incidental Mutation 'R7068:Smarcc1'
ID548692
Institutional Source Beutler Lab
Gene Symbol Smarcc1
Ensembl Gene ENSMUSG00000032481
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
SynonymsBAF155, SRG3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7068 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location110117708-110240178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110185884 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 506 (T506A)
Ref Sequence ENSEMBL: ENSMUSP00000086094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088716] [ENSMUST00000197480] [ENSMUST00000197984] [ENSMUST00000199896]
Predicted Effect probably damaging
Transcript: ENSMUST00000088716
AA Change: T506A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000086094
Gene: ENSMUSG00000032481
AA Change: T506A

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.7e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 9.6e-35 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 2.5e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
low complexity region 1075 1104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197480
SMART Domains Protein: ENSMUSP00000142629
Gene: ENSMUSG00000032481

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197984
AA Change: T506A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142611
Gene: ENSMUSG00000032481
AA Change: T506A

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 448 536 1.4e-35 PFAM
SANT 618 666 4.52e-12 SMART
low complexity region 710 717 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 768 781 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 866 885 N/A INTRINSIC
coiled coil region 909 945 N/A INTRINSIC
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199896
AA Change: T506A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143550
Gene: ENSMUSG00000032481
AA Change: T506A

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.5e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 1.4e-34 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 1.4e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out mutation display early embryonic lethality soon after decidualization due to failed egg cylinder formation and defects in the inner cell mass and primitive endoderm. About 20% of heterozygous mutant embryos show exencephaly caused by failure in neural fold elevation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,622,580 H24R probably benign Het
Ago2 A T 15: 73,146,450 F46L probably damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Arhgef10 T C 8: 14,958,639 F546L probably damaging Het
Asic2 G A 11: 81,152,255 H71Y probably benign Het
Asphd1 A G 7: 126,948,678 V151A probably benign Het
Best3 T C 10: 116,988,638 V3A probably damaging Het
C4b A G 17: 34,733,477 L1196P probably damaging Het
Cd22 A G 7: 30,878,079 V3A probably benign Het
Cdkl3 T C 11: 52,011,327 probably null Het
Clcnka A T 4: 141,387,110 V631E probably damaging Het
Cmya5 A G 13: 93,092,697 V1961A possibly damaging Het
Dnah14 A G 1: 181,769,790 E3559G probably benign Het
Emsy A T 7: 98,610,761 D39E probably benign Het
Fam126a A G 5: 23,964,795 S519P possibly damaging Het
Fbxl16 G T 17: 25,819,511 V477F possibly damaging Het
Flt1 A T 5: 147,673,634 I393N probably damaging Het
Gabra4 A T 5: 71,572,059 N433K probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Ghsr T A 3: 27,371,837 V14D probably benign Het
Glb1l A G 1: 75,202,737 Y183H probably damaging Het
Ighv3-4 T C 12: 114,253,654 T106A probably damaging Het
Ik T G 18: 36,755,465 F439V possibly damaging Het
Itih5 T C 2: 10,249,304 S789P probably damaging Het
Kcnj8 T C 6: 142,566,239 D214G probably damaging Het
Kdm5a C A 6: 120,430,215 H1464N probably benign Het
Klb A T 5: 65,379,340 Y671F probably damaging Het
Kremen2 C A 17: 23,741,885 R421L possibly damaging Het
Mroh9 T A 1: 163,039,181 D662V probably damaging Het
Mtmr12 T G 15: 12,257,670 M278R probably null Het
Ndufa8 T C 2: 36,044,435 M44V possibly damaging Het
Nedd4l A T 18: 65,205,651 R695S probably damaging Het
Nuf2 G A 1: 169,522,419 P97S probably damaging Het
Olfr1018 T C 2: 85,823,052 V27A probably benign Het
Olfr206 T C 16: 59,345,204 T166A possibly damaging Het
Olfr310 A C 7: 86,269,537 L84R probably damaging Het
P4ha2 A G 11: 54,110,994 T33A probably benign Het
Parp1 A G 1: 180,588,668 H544R probably damaging Het
Plec A G 15: 76,177,769 L2678P probably damaging Het
Rad1 T A 15: 10,490,293 Y85* probably null Het
Sema6d A G 2: 124,657,821 I309V probably benign Het
Skint2 T C 4: 112,624,351 V137A probably damaging Het
Slc23a3 T C 1: 75,133,233 N130S probably benign Het
Slc35f1 T C 10: 53,062,500 F176S probably damaging Het
Slc44a2 T A 9: 21,320,848 Y10N probably benign Het
Smchd1 A T 17: 71,387,092 S1219R probably benign Het
Smco1 A G 16: 32,274,111 N200S probably benign Het
Srcap A G 7: 127,541,943 T1571A probably benign Het
Strip2 C T 6: 29,932,208 T459I probably benign Het
Tarbp1 C T 8: 126,427,034 A1560T probably damaging Het
Tcl1b1 T A 12: 105,159,693 probably benign Het
Tdrd5 T C 1: 156,284,271 E436G probably damaging Het
Trim31 T A 17: 36,898,516 C55S probably damaging Het
Tsr1 G T 11: 74,903,919 E467* probably null Het
Tulp4 T A 17: 6,185,289 D178E probably damaging Het
Vmn1r30 A G 6: 58,435,010 V279A possibly damaging Het
Vmn2r98 A G 17: 19,065,313 R132G probably benign Het
Other mutations in Smarcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Smarcc1 APN 9 110221937 missense probably damaging 1.00
IGL01152:Smarcc1 APN 9 110139625 missense possibly damaging 0.89
IGL01353:Smarcc1 APN 9 110135666 missense probably benign 0.07
IGL01401:Smarcc1 APN 9 110149965 missense possibly damaging 0.52
IGL01483:Smarcc1 APN 9 110222060 nonsense probably null
IGL01679:Smarcc1 APN 9 110213530 missense probably damaging 1.00
IGL02458:Smarcc1 APN 9 110132126 intron probably benign
IGL02498:Smarcc1 APN 9 110190934 missense probably damaging 1.00
IGL02605:Smarcc1 APN 9 110222000 missense possibly damaging 0.86
IGL03003:Smarcc1 APN 9 110206100 missense probably damaging 0.97
IGL03284:Smarcc1 APN 9 110175074 missense probably benign 0.30
R0116:Smarcc1 UTSW 9 110147104 missense possibly damaging 0.71
R0403:Smarcc1 UTSW 9 110237808 splice site probably null
R1436:Smarcc1 UTSW 9 110118640 unclassified probably benign
R1583:Smarcc1 UTSW 9 110213617 missense probably damaging 1.00
R1692:Smarcc1 UTSW 9 110174004 missense possibly damaging 0.85
R1732:Smarcc1 UTSW 9 110185820 splice site probably benign
R1833:Smarcc1 UTSW 9 110153811 missense possibly damaging 0.71
R1881:Smarcc1 UTSW 9 110175099 missense probably damaging 1.00
R2058:Smarcc1 UTSW 9 110118343 unclassified probably benign
R2175:Smarcc1 UTSW 9 110164809 missense possibly damaging 0.71
R2215:Smarcc1 UTSW 9 110237839 utr 3 prime probably benign
R2904:Smarcc1 UTSW 9 110173975 missense possibly damaging 0.80
R3899:Smarcc1 UTSW 9 110118518 unclassified probably benign
R3900:Smarcc1 UTSW 9 110118518 unclassified probably benign
R4012:Smarcc1 UTSW 9 110132205 missense possibly damaging 0.96
R4091:Smarcc1 UTSW 9 110164829 missense possibly damaging 0.84
R4356:Smarcc1 UTSW 9 110196256 missense probably damaging 0.99
R4881:Smarcc1 UTSW 9 110135628 start gained probably benign
R4993:Smarcc1 UTSW 9 110175061 missense probably damaging 1.00
R5110:Smarcc1 UTSW 9 110197784 missense possibly damaging 0.89
R5375:Smarcc1 UTSW 9 110190949 missense probably damaging 0.99
R5655:Smarcc1 UTSW 9 110157344 missense probably null 1.00
R5715:Smarcc1 UTSW 9 110196367 missense possibly damaging 0.95
R5767:Smarcc1 UTSW 9 110132183 intron probably benign
R5816:Smarcc1 UTSW 9 110197644 missense possibly damaging 0.51
R6969:Smarcc1 UTSW 9 110196320 missense probably damaging 1.00
R7211:Smarcc1 UTSW 9 110150014 missense probably damaging 0.97
T0722:Smarcc1 UTSW 9 110206085 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CCACATGTTCACCTTACAATGG -3'
(R):5'- CCTTGCACACATGATGCAGG -3'

Sequencing Primer
(F):5'- GTTCACCTTACAATGGCTGTATAC -3'
(R):5'- CTTGCACACATGATGCAGGTAAATAG -3'
Posted On2019-05-13