Incidental Mutation 'R0613:Mtor'
ID54876
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Namemechanistic target of rapamycin kinase
SynonymsRAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik
MMRRC Submission 038802-MU
Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0613 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148448611-148557683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148526046 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1605 (Y1605H)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103221
AA Change: Y1605H

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: Y1605H

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Meta Mutation Damage Score 0.3 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (72/72)
MGI Phenotype Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acd A T 8: 105,700,568 probably null Het
Adcy9 A G 16: 4,419,539 S3P probably damaging Het
Adgrl4 T C 3: 151,543,222 probably benign Het
Aff3 T C 1: 38,209,923 E700G probably benign Het
Ahctf1 A G 1: 179,769,414 S56P probably damaging Het
Atp12a T A 14: 56,374,521 I384N probably damaging Het
Brca1 A T 11: 101,508,210 S1519T probably benign Het
Ccl25 T C 8: 4,349,850 V94A probably benign Het
Cep170 T C 1: 176,774,680 T287A probably benign Het
Ces1a A G 8: 93,025,581 S383P probably benign Het
Cntnap3 A T 13: 64,758,414 F793I probably damaging Het
Ctsm T C 13: 61,539,682 R89G probably damaging Het
Cyp2j12 T G 4: 96,102,079 T417P probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Edn2 T A 4: 120,161,864 probably null Het
Emc1 T A 4: 139,375,072 probably benign Het
Fam189a2 T A 19: 23,986,489 N239Y probably damaging Het
Fras1 T C 5: 96,700,488 probably benign Het
Fsip2 A T 2: 82,993,795 D6624V probably damaging Het
Gpr107 A G 2: 31,178,285 Y253C probably damaging Het
Gpr108 A G 17: 57,238,174 probably benign Het
Grik1 A G 16: 88,051,333 probably null Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Gucy2c A T 6: 136,760,723 N293K probably damaging Het
Hps6 C A 19: 46,003,821 P66T probably benign Het
Hspa9 A T 18: 34,947,980 V216E probably damaging Het
Igsf8 T A 1: 172,317,589 M224K probably benign Het
Igsf9b T C 9: 27,326,920 V569A probably damaging Het
Itgb4 A T 11: 115,993,342 I952F probably damaging Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Khdrbs2 A G 1: 32,657,522 H344R possibly damaging Het
Kmo C A 1: 175,637,892 R71S probably damaging Het
Lrrc31 A G 3: 30,685,035 probably benign Het
Map1b T A 13: 99,441,641 D168V probably damaging Het
Mfsd6 T C 1: 52,658,696 probably benign Het
Mgst1 G A 6: 138,156,245 G186D probably damaging Het
Mrc1 C T 2: 14,294,819 A740V probably damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Ncoa4 T A 14: 32,176,552 L443Q probably damaging Het
Nelfa G A 5: 33,903,463 probably benign Het
Nepn T A 10: 52,401,257 L363Q probably damaging Het
Nfat5 A G 8: 107,366,295 T630A possibly damaging Het
Nipal4 A T 11: 46,150,384 V328E probably benign Het
Olfr1228 A T 2: 89,249,125 C178S probably damaging Het
Olfr1391 T A 11: 49,327,748 S112R possibly damaging Het
Olfr462 A T 11: 87,889,227 V223E possibly damaging Het
Olfr747 T A 14: 50,681,404 I77F probably benign Het
Olfr809 T A 10: 129,776,262 M116K probably damaging Het
Olfr924 T A 9: 38,848,613 C166* probably null Het
Otogl A T 10: 107,817,070 N1140K probably damaging Het
Ppip5k2 A C 1: 97,752,740 Y236* probably null Het
Prelid1 C T 13: 55,324,343 R111* probably null Het
Prpf8 T C 11: 75,503,444 L1771P probably damaging Het
Ptprb A T 10: 116,302,325 Y378F possibly damaging Het
Ptprb A G 10: 116,302,378 T396A possibly damaging Het
Rab3il1 T C 19: 10,028,364 L174P probably damaging Het
Rab4a T C 8: 123,823,835 V18A possibly damaging Het
Scn3a T A 2: 65,472,284 M1273L possibly damaging Het
Sdhc A T 1: 171,129,844 V156E probably benign Het
Slco3a1 T C 7: 74,346,634 probably benign Het
Syne3 T C 12: 104,958,112 T343A probably benign Het
Syt11 A G 3: 88,762,469 C39R probably damaging Het
Tll2 G T 19: 41,104,990 D462E probably damaging Het
Tmem132e T A 11: 82,438,338 V481D probably damaging Het
Tmem161b C T 13: 84,251,320 L17F probably damaging Het
Vmn2r105 T A 17: 20,208,316 I833F probably damaging Het
Vstm2a A T 11: 16,263,140 N175I probably damaging Het
Xpnpep1 G T 19: 53,006,353 D238E probably damaging Het
Zfp112 G A 7: 24,127,028 G807D probably benign Het
Zfp518b A T 5: 38,673,603 V353E probably damaging Het
Zfp69 T C 4: 120,934,347 E39G probably benign Het
Zfp865 A G 7: 5,029,091 H25R possibly damaging Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148453037 missense probably benign 0.06
IGL01447:Mtor APN 4 148530757 missense possibly damaging 0.62
IGL01551:Mtor APN 4 148472037 missense probably damaging 0.99
IGL01661:Mtor APN 4 148514851 missense possibly damaging 0.61
IGL01675:Mtor APN 4 148484654 missense probably benign 0.00
IGL01743:Mtor APN 4 148530613 splice site probably benign
IGL02015:Mtor APN 4 148540113 nonsense probably null
IGL02084:Mtor APN 4 148470680 missense probably damaging 0.98
IGL02095:Mtor APN 4 148544541 missense probably damaging 1.00
IGL02129:Mtor APN 4 148549845 missense possibly damaging 0.91
IGL02260:Mtor APN 4 148538301 missense probably damaging 1.00
IGL02329:Mtor APN 4 148534939 missense probably benign 0.16
IGL02440:Mtor APN 4 148546429 missense probably benign 0.24
IGL02440:Mtor APN 4 148491647 missense probably benign 0.04
IGL02449:Mtor APN 4 148533921 missense possibly damaging 0.65
IGL02479:Mtor APN 4 148470584 missense probably damaging 1.00
IGL02904:Mtor APN 4 148452394 missense possibly damaging 0.55
IGL02904:Mtor APN 4 148491612 splice site probably benign
IGL02931:Mtor APN 4 148464964 missense probably benign 0.22
IGL03048:Mtor APN 4 148546390 splice site probably benign
IGL03133:Mtor APN 4 148484319 missense probably benign 0.01
IGL03142:Mtor APN 4 148453899 missense probably benign 0.00
dynamo UTSW 4 148462910 missense probably benign 0.00
engine UTSW 4 148556855 unclassified probably null
motor UTSW 4 148491360 missense possibly damaging 0.76
PIT4519001:Mtor UTSW 4 148524500 missense probably damaging 1.00
R0045:Mtor UTSW 4 148464949 missense probably benign 0.42
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0103:Mtor UTSW 4 148533902 missense probably benign 0.05
R0112:Mtor UTSW 4 148480923 missense probably damaging 1.00
R0137:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R0184:Mtor UTSW 4 148464971 missense probably benign 0.05
R0208:Mtor UTSW 4 148464975 missense probably benign 0.43
R0329:Mtor UTSW 4 148484380 missense probably benign
R0330:Mtor UTSW 4 148484380 missense probably benign
R0365:Mtor UTSW 4 148486050 missense probably benign 0.01
R0537:Mtor UTSW 4 148538360 missense probably damaging 1.00
R0542:Mtor UTSW 4 148540450 missense probably benign 0.02
R0556:Mtor UTSW 4 148469380 missense possibly damaging 0.88
R0646:Mtor UTSW 4 148484354 nonsense probably null
R0710:Mtor UTSW 4 148464391 missense possibly damaging 0.73
R0791:Mtor UTSW 4 148462910 missense probably benign 0.00
R0792:Mtor UTSW 4 148462910 missense probably benign 0.00
R0866:Mtor UTSW 4 148486056 missense probably benign 0.04
R0973:Mtor UTSW 4 148550188 missense probably damaging 1.00
R1027:Mtor UTSW 4 148539999 missense probably benign 0.03
R1028:Mtor UTSW 4 148538830 missense possibly damaging 0.88
R1289:Mtor UTSW 4 148470307 missense probably benign 0.10
R1416:Mtor UTSW 4 148491414 nonsense probably null
R1465:Mtor UTSW 4 148525993 splice site probably benign
R1506:Mtor UTSW 4 148536505 splice site probably benign
R1624:Mtor UTSW 4 148547676 missense probably damaging 1.00
R1695:Mtor UTSW 4 148538907 missense probably benign 0.08
R1771:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R1800:Mtor UTSW 4 148462892 missense probably benign 0.00
R1855:Mtor UTSW 4 148553089 missense probably benign 0.02
R1857:Mtor UTSW 4 148480879 missense probably damaging 1.00
R1867:Mtor UTSW 4 148454632 missense probably damaging 0.97
R1954:Mtor UTSW 4 148468273 missense probably damaging 1.00
R2054:Mtor UTSW 4 148462852 missense probably benign 0.05
R2054:Mtor UTSW 4 148466025 missense probably benign 0.00
R2099:Mtor UTSW 4 148550192 nonsense probably null
R2148:Mtor UTSW 4 148456012 missense possibly damaging 0.56
R2214:Mtor UTSW 4 148538870 missense probably benign 0.39
R2281:Mtor UTSW 4 148489555 missense probably benign 0.02
R2512:Mtor UTSW 4 148530491 missense possibly damaging 0.95
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2873:Mtor UTSW 4 148540030 missense probably benign 0.00
R4032:Mtor UTSW 4 148536752 missense probably benign 0.03
R4073:Mtor UTSW 4 148549375 missense probably damaging 0.99
R4273:Mtor UTSW 4 148550152 missense probably benign 0.21
R4611:Mtor UTSW 4 148486119 missense probably benign 0.03
R4858:Mtor UTSW 4 148454816 makesense probably null
R4942:Mtor UTSW 4 148472142 missense probably benign 0.03
R4967:Mtor UTSW 4 148491360 missense possibly damaging 0.76
R4995:Mtor UTSW 4 148525752 missense probably damaging 1.00
R5054:Mtor UTSW 4 148556855 unclassified probably null
R5215:Mtor UTSW 4 148453983 missense probably benign
R5249:Mtor UTSW 4 148463732 missense probably damaging 1.00
R5289:Mtor UTSW 4 148466092 missense possibly damaging 0.88
R5365:Mtor UTSW 4 148550130 missense probably damaging 0.99
R5498:Mtor UTSW 4 148540364 missense possibly damaging 0.71
R5514:Mtor UTSW 4 148546444 missense probably damaging 1.00
R5540:Mtor UTSW 4 148454708 missense probably benign 0.01
R5600:Mtor UTSW 4 148491470 missense probably damaging 1.00
R5615:Mtor UTSW 4 148538276 missense possibly damaging 0.95
R5632:Mtor UTSW 4 148469006 missense possibly damaging 0.94
R5641:Mtor UTSW 4 148546425 missense probably damaging 0.98
R5834:Mtor UTSW 4 148536536 missense possibly damaging 0.95
R5984:Mtor UTSW 4 148538827 missense probably benign 0.02
R6056:Mtor UTSW 4 148537435 missense probably benign 0.00
R6225:Mtor UTSW 4 148521337 missense probably benign 0.04
R6262:Mtor UTSW 4 148526095 missense possibly damaging 0.46
R6335:Mtor UTSW 4 148465927 missense probably damaging 1.00
R6479:Mtor UTSW 4 148551000 missense probably benign 0.16
R6543:Mtor UTSW 4 148545596 missense probably damaging 1.00
R6711:Mtor UTSW 4 148452367 missense possibly damaging 0.49
R6715:Mtor UTSW 4 148538547 missense probably benign 0.00
R6744:Mtor UTSW 4 148458655 missense probably benign 0.01
R6748:Mtor UTSW 4 148550184 missense probably damaging 1.00
R6762:Mtor UTSW 4 148538481 missense possibly damaging 0.47
R6836:Mtor UTSW 4 148489498 missense possibly damaging 0.94
R6948:Mtor UTSW 4 148536752 missense probably benign 0.12
R6979:Mtor UTSW 4 148524473 missense possibly damaging 0.60
R6992:Mtor UTSW 4 148464475 missense probably benign
R7271:Mtor UTSW 4 148546485 missense possibly damaging 0.70
X0025:Mtor UTSW 4 148530714 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCACGTTGTCAGAATCTACAGCCC -3'
(R):5'- CAGTGAGTCCCAGGTTACCATTTCC -3'

Sequencing Primer
(F):5'- TGTCAGAATCTACAGCCCTAATGAG -3'
(R):5'- ACCATTTCCAAGTGGAGGGTC -3'
Posted On2013-07-11