Incidental Mutation 'R7070:Kndc1'
ID548836
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Namekinase non-catalytic C-lobe domain (KIND) containing 1
SynonymsB830014K08Rik, 2410012C07Rik, very-kind, VKIND
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7070 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location139894696-139941537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139921828 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 927 (E927G)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
Predicted Effect probably damaging
Transcript: ENSMUST00000053445
AA Change: E927G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: E927G

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,953,248 Y156H probably damaging Het
Abca13 T A 11: 9,290,701 F855I probably benign Het
Abca2 T G 2: 25,442,995 F1569V probably benign Het
Adcy8 T A 15: 64,920,555 N184I probably damaging Het
Akap3 T C 6: 126,874,024 V835A probably damaging Het
Atg5 T A 10: 44,286,154 L22H probably damaging Het
Atp13a5 A G 16: 29,334,061 F196L possibly damaging Het
C1qtnf9 A G 14: 60,779,783 H254R probably damaging Het
Capza3 C T 6: 140,041,920 R82C probably damaging Het
Ccdc126 A G 6: 49,339,862 D92G probably damaging Het
Cdh12 T A 15: 21,583,829 M585K probably benign Het
Chrnb3 A T 8: 27,393,961 Y242F probably damaging Het
Cngb3 T C 4: 19,425,593 V467A possibly damaging Het
Cnot8 A G 11: 58,117,452 D248G probably benign Het
Cntn1 C T 15: 92,254,036 T452M probably damaging Het
Cygb C A 11: 116,654,025 probably benign Het
D930020B18Rik G A 10: 121,641,974 V35M probably damaging Het
Dcaf17 C T 2: 71,088,513 T477M probably benign Het
Dpp3 A T 19: 4,918,328 F239I probably benign Het
Dst T A 1: 34,275,302 V6442E probably damaging Het
Enpp2 T A 15: 54,899,289 I188F probably damaging Het
Galnt5 A G 2: 57,998,609 M74V probably benign Het
Grin2a T C 16: 9,579,424 D933G possibly damaging Het
Gtf2i T A 5: 134,282,803 E223D probably damaging Het
H2-M5 C A 17: 36,989,159 G41V possibly damaging Het
Hars2 C T 18: 36,791,112 R501* probably null Het
Heatr4 A G 12: 83,969,858 V545A probably benign Het
Hsd3b3 T A 3: 98,742,471 T179S possibly damaging Het
Ighv5-6 A G 12: 113,625,809 V17A probably damaging Het
Jak3 A G 8: 71,684,611 D772G probably damaging Het
Jakmip2 A T 18: 43,557,328 probably null Het
Kcnj15 C G 16: 95,295,831 T104S probably damaging Het
Larp1b G T 3: 40,976,651 G275C probably damaging Het
Lyst C A 13: 13,757,444 H3552Q probably benign Het
Mast2 A T 4: 116,310,855 I960N probably benign Het
Mcee G A 7: 64,400,330 V70I possibly damaging Het
Muc16 G A 9: 18,645,923 Q3025* probably null Het
Nrg1 T A 8: 31,849,437 T45S probably damaging Het
Nutm1 T A 2: 112,249,461 H703L probably benign Het
Olfr1023 G A 2: 85,887,690 V297I probably benign Het
Olfr1354 A T 10: 78,917,268 I143L probably benign Het
Pbx1 A C 1: 168,195,768 C273G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Phf1 A G 17: 26,934,333 T42A possibly damaging Het
Pigm T A 1: 172,377,666 I323N probably damaging Het
Plcg2 G A 8: 117,596,306 R700H probably benign Het
Ptx4 G A 17: 25,122,997 A149T probably benign Het
Rab6a A G 7: 100,629,857 D68G probably damaging Het
Rcan3 C T 4: 135,416,587 E185K probably damaging Het
Rnf14 A G 18: 38,301,728 N76S possibly damaging Het
Rpf1 A T 3: 146,512,184 F192I probably damaging Het
Rps6ka1 T C 4: 133,861,448 T285A probably benign Het
Rrp8 T C 7: 105,734,876 K94E possibly damaging Het
Rsbn1 A G 3: 103,928,983 K122E probably damaging Het
Senp1 T C 15: 98,082,306 T53A possibly damaging Het
Slc23a1 T G 18: 35,621,781 D519A probably damaging Het
Slfn14 T G 11: 83,276,705 R661S probably benign Het
Snta1 T C 2: 154,381,059 E248G probably benign Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stk11ip C T 1: 75,527,615 H297Y probably benign Het
Synpr T A 14: 13,493,628 F76I probably damaging Het
Thegl G T 5: 77,047,277 probably null Het
Tns2 A G 15: 102,104,533 R27G possibly damaging Het
Trav5-4 C T 14: 53,704,455 S95F possibly damaging Het
Ttyh1 T C 7: 4,133,364 Y330H probably damaging Het
Ugt1a2 T A 1: 88,201,502 probably null Het
Vmn2r69 T C 7: 85,411,480 I299V probably damaging Het
Vmn2r90 T A 17: 17,704,051 D37E probably damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCCTGCACCTCTTCAAC -3'
(R):5'- AGTCACAAGCAGCACCATGG -3'

Sequencing Primer
(F):5'- TCTTCAACCCCAAAGTCCTGAG -3'
(R):5'- ACCATGGAGTTGCCCTTG -3'
Posted On2019-05-13