Incidental Mutation 'R7072:Dyrk3'
ID548928
Institutional Source Beutler Lab
Gene Symbol Dyrk3
Ensembl Gene ENSMUSG00000016526
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R7072 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location131127455-131138340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131129728 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 236 (L236Q)
Ref Sequence ENSEMBL: ENSMUSP00000016670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016670] [ENSMUST00000189756]
Predicted Effect probably damaging
Transcript: ENSMUST00000016670
AA Change: L236Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016670
Gene: ENSMUSG00000016526
AA Change: L236Q

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
S_TKc 208 521 2.45e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189756
SMART Domains Protein: ENSMUSP00000140050
Gene: ENSMUSG00000016526

DomainStartEndE-ValueType
PDB:4AZF|A 101 152 3e-18 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the DYRK family of dual-specificity protein kinases that catalyze autophosphorylation on serine/threonine and tyrosine residues. The members of this family share structural similarity, however, differ in their substrate specificity, suggesting their involvement in different cellular functions. The encoded protein has been shown to autophosphorylate on tyrosine residue and catalyze phosphorylation of histones H3 and H2B in vitro. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased erythropoiesis in response to chemically-induced anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,173,943 L2214Q probably damaging Het
Acbd3 T C 1: 180,726,369 F90L probably benign Het
Ahnak2 T A 12: 112,788,166 Q23L Het
Anpep A T 7: 79,835,379 L620I possibly damaging Het
Bpi T C 2: 158,272,078 S299P probably damaging Het
Bpifa2 A G 2: 154,011,373 D132G probably damaging Het
Brd7 T A 8: 88,346,987 E258D probably benign Het
Btc T C 5: 91,402,937 probably benign Het
Cacna1c A G 6: 118,596,106 V2039A Het
Calm4 T A 13: 3,838,275 V127E probably benign Het
Casp8ap2 T A 4: 32,644,766 S1280T probably damaging Het
Cc2d2b T C 19: 40,760,359 V80A unknown Het
Ccdc33 A G 9: 58,111,984 *279R probably null Het
Cercam T A 2: 29,881,924 H585Q probably benign Het
Cnnm1 A G 19: 43,440,857 D138G probably benign Het
Cox4i2 T C 2: 152,760,653 F89S probably damaging Het
Crb1 G A 1: 139,237,275 T1098I probably damaging Het
Csnk1e C T 15: 79,438,767 probably null Het
Ctsj C A 13: 61,003,083 E187* probably null Het
D730001G18Rik C T 15: 74,772,270 V66M Het
Dagla A T 19: 10,256,295 probably null Het
Dnah7a G A 1: 53,419,753 T3742I probably benign Het
Dnajc6 A C 4: 101,615,615 H381P probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Frmd5 A T 2: 121,557,870 L241Q probably damaging Het
Gcc2 A G 10: 58,270,927 T662A probably benign Het
Gins1 C T 2: 150,909,751 probably null Het
Gli3 T A 13: 15,725,695 N1222K possibly damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm4302 G T 10: 100,341,659 Q268H unknown Het
Grin2d A T 7: 45,857,498 W518R probably damaging Het
Grm5 A T 7: 88,074,304 I601F probably damaging Het
Gtpbp10 A T 5: 5,546,365 N193K probably benign Het
Igdcc4 T G 9: 65,130,731 V798G probably damaging Het
Igkv8-19 A T 6: 70,341,412 F13I probably benign Het
Kctd11 T A 11: 69,879,795 N139I probably benign Het
Lmo7 G A 14: 101,898,700 probably null Het
Lrrk2 A T 15: 91,801,920 M2155L probably benign Het
Mettl24 A C 10: 40,683,513 H53P probably benign Het
Mier2 A G 10: 79,540,299 M264T unknown Het
Mplkip T C 13: 17,695,537 I18T unknown Het
Mtmr2 T C 9: 13,788,620 V101A probably benign Het
Nbeal2 G T 9: 110,626,051 T2593K probably benign Het
Neu3 A T 7: 99,814,197 C106* probably null Het
Nutm1 T C 2: 112,251,847 T295A probably benign Het
Olfr753-ps1 A G 17: 37,170,378 I90T probably benign Het
Pcdhga7 G T 18: 37,717,276 V779L probably benign Het
Pde10a A G 17: 8,943,026 E231G probably benign Het
Plcg2 T A 8: 117,589,835 probably null Het
Pofut2 T C 10: 77,259,429 L36P probably benign Het
Pou6f2 T C 13: 18,125,169 N635S Het
Pramef17 A C 4: 143,994,128 I81R probably damaging Het
Ptpra T C 2: 130,553,430 Y818H probably damaging Het
Rad18 T C 6: 112,681,440 E168G probably benign Het
Rev1 C A 1: 38,067,545 E634* probably null Het
Sec24d A G 3: 123,330,351 D403G probably damaging Het
Sema5a C A 15: 32,574,959 H404Q possibly damaging Het
Shank1 A G 7: 44,344,946 S844G unknown Het
Slc32a1 T A 2: 158,611,496 Y85* probably null Het
Slc39a4 T C 15: 76,613,258 T485A probably damaging Het
Sp5 A C 2: 70,476,730 Q253P probably benign Het
Sspo A T 6: 48,454,979 D709V probably damaging Het
Sucnr1 A G 3: 60,086,183 Y44C probably damaging Het
Taar8b A G 10: 24,091,978 L106P possibly damaging Het
Tbc1d9 A G 8: 83,264,865 D922G probably damaging Het
Tbx6 A T 7: 126,784,740 D322V probably benign Het
Tex15 T A 8: 33,575,431 S1630T possibly damaging Het
Ube2o G A 11: 116,541,501 P880S probably benign Het
Uck1 C T 2: 32,258,166 R182Q probably damaging Het
Utrn T A 10: 12,465,213 H2840L probably damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Wnk1 A T 6: 119,937,861 I1909N unknown Het
Zfp352 C T 4: 90,224,424 T267I probably benign Het
Zfp773 A T 7: 7,132,875 C241S probably benign Het
Zfp934 T C 13: 62,520,525 D8G probably damaging Het
Other mutations in Dyrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Dyrk3 APN 1 131136337 missense possibly damaging 0.71
IGL00910:Dyrk3 APN 1 131136336 missense possibly damaging 0.92
IGL02436:Dyrk3 APN 1 131128865 missense probably benign 0.00
IGL03057:Dyrk3 APN 1 131129078 missense probably benign 0.01
PIT4576001:Dyrk3 UTSW 1 131130181 missense probably damaging 0.98
R0116:Dyrk3 UTSW 1 131129839 missense probably damaging 1.00
R0361:Dyrk3 UTSW 1 131130032 missense probably benign 0.00
R0457:Dyrk3 UTSW 1 131136357 missense possibly damaging 0.94
R0529:Dyrk3 UTSW 1 131130121 missense probably benign 0.00
R0724:Dyrk3 UTSW 1 131130140 missense probably benign 0.00
R1116:Dyrk3 UTSW 1 131129182 missense probably damaging 1.00
R2999:Dyrk3 UTSW 1 131129446 missense probably damaging 1.00
R3423:Dyrk3 UTSW 1 131129482 missense probably damaging 1.00
R4591:Dyrk3 UTSW 1 131130158 missense probably damaging 1.00
R5358:Dyrk3 UTSW 1 131129695 missense probably damaging 1.00
R5608:Dyrk3 UTSW 1 131128715 missense probably benign
R6767:Dyrk3 UTSW 1 131129590 missense probably damaging 0.99
Z1088:Dyrk3 UTSW 1 131129233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTAGCAGTTCAAAGGCC -3'
(R):5'- GAAGCTGGAGATCGTCAGCTAC -3'

Sequencing Primer
(F):5'- TTAGCAGTTCAAAGGCCATGCAC -3'
(R):5'- CAGCTACCCAGAAATCTACTTTGTG -3'
Posted On2019-05-15