Incidental Mutation 'R7072:Sec24d'
ID548943
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene NameSec24 related gene family, member D (S. cerevisiae)
Synonyms2310020L09Rik, LOC383951
MMRRC Submission
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7072 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location123267455-123365641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123330351 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 403 (D403G)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
Predicted Effect probably damaging
Transcript: ENSMUST00000047923
AA Change: D403G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: D403G

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,173,943 L2214Q probably damaging Het
Acbd3 T C 1: 180,726,369 F90L probably benign Het
Ahnak2 T A 12: 112,788,166 Q23L Het
Anpep A T 7: 79,835,379 L620I possibly damaging Het
Bpi T C 2: 158,272,078 S299P probably damaging Het
Bpifa2 A G 2: 154,011,373 D132G probably damaging Het
Brd7 T A 8: 88,346,987 E258D probably benign Het
Btc T C 5: 91,402,937 probably benign Het
Cacna1c A G 6: 118,596,106 V2039A Het
Calm4 T A 13: 3,838,275 V127E probably benign Het
Casp8ap2 T A 4: 32,644,766 S1280T probably damaging Het
Cc2d2b T C 19: 40,760,359 V80A unknown Het
Ccdc33 A G 9: 58,111,984 *279R probably null Het
Cercam T A 2: 29,881,924 H585Q probably benign Het
Cnnm1 A G 19: 43,440,857 D138G probably benign Het
Cox4i2 T C 2: 152,760,653 F89S probably damaging Het
Crb1 G A 1: 139,237,275 T1098I probably damaging Het
Csnk1e C T 15: 79,438,767 probably null Het
Ctsj C A 13: 61,003,083 E187* probably null Het
D730001G18Rik C T 15: 74,772,270 V66M Het
Dagla A T 19: 10,256,295 probably null Het
Dnah7a G A 1: 53,419,753 T3742I probably benign Het
Dnajc6 A C 4: 101,615,615 H381P probably damaging Het
Dyrk3 A T 1: 131,129,728 L236Q probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Frmd5 A T 2: 121,557,870 L241Q probably damaging Het
Gcc2 A G 10: 58,270,927 T662A probably benign Het
Gins1 C T 2: 150,909,751 probably null Het
Gli3 T A 13: 15,725,695 N1222K possibly damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm4302 G T 10: 100,341,659 Q268H unknown Het
Grin2d A T 7: 45,857,498 W518R probably damaging Het
Grm5 A T 7: 88,074,304 I601F probably damaging Het
Gtpbp10 A T 5: 5,546,365 N193K probably benign Het
Igdcc4 T G 9: 65,130,731 V798G probably damaging Het
Igkv8-19 A T 6: 70,341,412 F13I probably benign Het
Kctd11 T A 11: 69,879,795 N139I probably benign Het
Lmo7 G A 14: 101,898,700 probably null Het
Lrrk2 A T 15: 91,801,920 M2155L probably benign Het
Mettl24 A C 10: 40,683,513 H53P probably benign Het
Mier2 A G 10: 79,540,299 M264T unknown Het
Mplkip T C 13: 17,695,537 I18T unknown Het
Mtmr2 T C 9: 13,788,620 V101A probably benign Het
Nbeal2 G T 9: 110,626,051 T2593K probably benign Het
Neu3 A T 7: 99,814,197 C106* probably null Het
Nutm1 T C 2: 112,251,847 T295A probably benign Het
Olfr753-ps1 A G 17: 37,170,378 I90T probably benign Het
Pcdhga7 G T 18: 37,717,276 V779L probably benign Het
Pde10a A G 17: 8,943,026 E231G probably benign Het
Plcg2 T A 8: 117,589,835 probably null Het
Pofut2 T C 10: 77,259,429 L36P probably benign Het
Pou6f2 T C 13: 18,125,169 N635S Het
Pramef17 A C 4: 143,994,128 I81R probably damaging Het
Ptpra T C 2: 130,553,430 Y818H probably damaging Het
Rad18 T C 6: 112,681,440 E168G probably benign Het
Rev1 C A 1: 38,067,545 E634* probably null Het
Sema5a C A 15: 32,574,959 H404Q possibly damaging Het
Shank1 A G 7: 44,344,946 S844G unknown Het
Slc32a1 T A 2: 158,611,496 Y85* probably null Het
Slc39a4 T C 15: 76,613,258 T485A probably damaging Het
Sp5 A C 2: 70,476,730 Q253P probably benign Het
Sspo A T 6: 48,454,979 D709V probably damaging Het
Sucnr1 A G 3: 60,086,183 Y44C probably damaging Het
Taar8b A G 10: 24,091,978 L106P possibly damaging Het
Tbc1d9 A G 8: 83,264,865 D922G probably damaging Het
Tbx6 A T 7: 126,784,740 D322V probably benign Het
Tex15 T A 8: 33,575,431 S1630T possibly damaging Het
Ube2o G A 11: 116,541,501 P880S probably benign Het
Uck1 C T 2: 32,258,166 R182Q probably damaging Het
Utrn T A 10: 12,465,213 H2840L probably damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Wnk1 A T 6: 119,937,861 I1909N unknown Het
Zfp352 C T 4: 90,224,424 T267I probably benign Het
Zfp773 A T 7: 7,132,875 C241S probably benign Het
Zfp934 T C 13: 62,520,525 D8G probably damaging Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGGTTTACAACATATACAAGAGCC -3'
(R):5'- TGCCCTGGAAATGTCTGTCTG -3'

Sequencing Primer
(F):5'- TATACAAGAGCCAAAAAGTTAGTGAG -3'
(R):5'- GGAAATGTCTGTCTGTGAACCAAGTC -3'
Posted On2019-05-15