Incidental Mutation 'R7072:Casp8ap2'
ID548944
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Namecaspase 8 associated protein 2
SynonymsFLASH, D4Ertd659e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7072 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location32615451-32653265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32644766 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1280 (S1280T)
Ref Sequence ENSEMBL: ENSMUSP00000029950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
Predicted Effect probably damaging
Transcript: ENSMUST00000029950
AA Change: S1280T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: S1280T

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108178
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000178925
AA Change: S1280T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: S1280T

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,173,943 L2214Q probably damaging Het
Acbd3 T C 1: 180,726,369 F90L probably benign Het
Ahnak2 T A 12: 112,788,166 Q23L Het
Anpep A T 7: 79,835,379 L620I possibly damaging Het
Bpi T C 2: 158,272,078 S299P probably damaging Het
Bpifa2 A G 2: 154,011,373 D132G probably damaging Het
Brd7 T A 8: 88,346,987 E258D probably benign Het
Btc T C 5: 91,402,937 probably benign Het
Cacna1c A G 6: 118,596,106 V2039A Het
Calm4 T A 13: 3,838,275 V127E probably benign Het
Cc2d2b T C 19: 40,760,359 V80A unknown Het
Ccdc33 A G 9: 58,111,984 *279R probably null Het
Cercam T A 2: 29,881,924 H585Q probably benign Het
Cnnm1 A G 19: 43,440,857 D138G probably benign Het
Cox4i2 T C 2: 152,760,653 F89S probably damaging Het
Crb1 G A 1: 139,237,275 T1098I probably damaging Het
Ctsj C A 13: 61,003,083 E187* probably null Het
D730001G18Rik C T 15: 74,772,270 V66M Het
Dagla A T 19: 10,256,295 probably null Het
Dnah7a G A 1: 53,419,753 T3742I probably benign Het
Dnajc6 A C 4: 101,615,615 H381P probably damaging Het
Dyrk3 A T 1: 131,129,728 L236Q probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Frmd5 A T 2: 121,557,870 L241Q probably damaging Het
Gcc2 A G 10: 58,270,927 T662A probably benign Het
Gli3 T A 13: 15,725,695 N1222K possibly damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm4302 G T 10: 100,341,659 Q268H unknown Het
Grin2d A T 7: 45,857,498 W518R probably damaging Het
Grm5 A T 7: 88,074,304 I601F probably damaging Het
Gtpbp10 A T 5: 5,546,365 N193K probably benign Het
Igdcc4 T G 9: 65,130,731 V798G probably damaging Het
Igkv8-19 A T 6: 70,341,412 F13I probably benign Het
Kctd11 T A 11: 69,879,795 N139I probably benign Het
Lmo7 G A 14: 101,898,700 probably null Het
Lrrk2 A T 15: 91,801,920 M2155L probably benign Het
Mettl24 A C 10: 40,683,513 H53P probably benign Het
Mier2 A G 10: 79,540,299 M264T unknown Het
Mplkip T C 13: 17,695,537 I18T unknown Het
Mtmr2 T C 9: 13,788,620 V101A probably benign Het
Nbeal2 G T 9: 110,626,051 T2593K probably benign Het
Neu3 A T 7: 99,814,197 C106* probably null Het
Nutm1 T C 2: 112,251,847 T295A probably benign Het
Pcdhga7 G T 18: 37,717,276 V779L probably benign Het
Pde10a A G 17: 8,943,026 E231G probably benign Het
Pofut2 T C 10: 77,259,429 L36P probably benign Het
Pou6f2 T C 13: 18,125,169 N635S Het
Pramef17 A C 4: 143,994,128 I81R probably damaging Het
Ptpra T C 2: 130,553,430 Y818H probably damaging Het
Rad18 T C 6: 112,681,440 E168G probably benign Het
Rev1 C A 1: 38,067,545 E634* probably null Het
Sec24d A G 3: 123,330,351 D403G probably damaging Het
Sema5a C A 15: 32,574,959 H404Q possibly damaging Het
Shank1 A G 7: 44,344,946 S844G unknown Het
Slc32a1 T A 2: 158,611,496 Y85* probably null Het
Slc39a4 T C 15: 76,613,258 T485A probably damaging Het
Sp5 A C 2: 70,476,730 Q253P probably benign Het
Sspo A T 6: 48,454,979 D709V probably damaging Het
Sucnr1 A G 3: 60,086,183 Y44C probably damaging Het
Taar8b A G 10: 24,091,978 L106P possibly damaging Het
Tbc1d9 A G 8: 83,264,865 D922G probably damaging Het
Tbx6 A T 7: 126,784,740 D322V probably benign Het
Tex15 T A 8: 33,575,431 S1630T possibly damaging Het
Ube2o G A 11: 116,541,501 P880S probably benign Het
Uck1 C T 2: 32,258,166 R182Q probably damaging Het
Utrn T A 10: 12,465,213 H2840L probably damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Wnk1 A T 6: 119,937,861 I1909N unknown Het
Zfp352 C T 4: 90,224,424 T267I probably benign Het
Zfp773 A T 7: 7,132,875 C241S probably benign Het
Zfp934 T C 13: 62,520,525 D8G probably damaging Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32641433 missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32649192 missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32641036 missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32645403 missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32646182 missense probably benign
IGL01534:Casp8ap2 APN 4 32648134 splice site probably benign
IGL01596:Casp8ap2 APN 4 32646365 missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32641294 missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32639391 missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32643974 missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32639704 missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32630246 missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32624105 utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32644590 missense probably benign 0.14
R0023:Casp8ap2 UTSW 4 32640185 missense probably damaging 0.99
R0027:Casp8ap2 UTSW 4 32643810 missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32640327 missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32640817 missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32643797 missense possibly damaging 0.50
R0268:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0344:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32640381 missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32640790 missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32640563 missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32645687 missense probably benign 0.03
R1311:Casp8ap2 UTSW 4 32648111 missense probably damaging 0.98
R1337:Casp8ap2 UTSW 4 32645721 missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32639386 nonsense probably null
R1497:Casp8ap2 UTSW 4 32639938 missense probably benign 0.00
R1521:Casp8ap2 UTSW 4 32631867 missense probably damaging 1.00
R1588:Casp8ap2 UTSW 4 32640541 missense probably benign 0.00
R1625:Casp8ap2 UTSW 4 32648068 missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32641442 missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32643647 missense probably damaging 0.98
R2000:Casp8ap2 UTSW 4 32634874 missense probably damaging 1.00
R2021:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2022:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2023:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32631126 missense probably damaging 1.00
R2104:Casp8ap2 UTSW 4 32644727 missense probably benign 0.00
R2128:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32646411 missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32643781 missense probably benign 0.31
R2919:Casp8ap2 UTSW 4 32645343 missense probably damaging 1.00
R4091:Casp8ap2 UTSW 4 32643611 missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32646150 missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32644505 missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32639807 missense probably benign
R4908:Casp8ap2 UTSW 4 32639905 missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32631163 missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32640554 missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32641400 missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32639380 missense probably damaging 1.00
R6257:Casp8ap2 UTSW 4 32641364 missense possibly damaging 0.94
R6289:Casp8ap2 UTSW 4 32639590 missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32634813 missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32641553 missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32646423 missense possibly damaging 0.64
R7015:Casp8ap2 UTSW 4 32644278 missense probably damaging 1.00
R7033:Casp8ap2 UTSW 4 32639392 missense probably damaging 1.00
V7580:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
X0018:Casp8ap2 UTSW 4 32643738 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTTGCAGTGATAATACAAAGAACGCTG -3'
(R):5'- ATCACTTTTGGACAAAGAGAAGCCC -3'

Sequencing Primer
(F):5'- CGCTGAATGTAAAGAGCAGTTTCTG -3'
(R):5'- GAAACCAGCTCTTCTGTTGCACAAG -3'
Posted On2019-05-15