Incidental Mutation 'R7074:Anapc1'
ID 549081
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Name anaphase promoting complex subunit 1
Synonyms Apc1, tsg24, Mcpr, 2610021O03Rik
MMRRC Submission 045242-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7074 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 128452024-128529311 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 128520194 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 208 (P208T)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]
AlphaFold P53995
Predicted Effect probably damaging
Transcript: ENSMUST00000014499
AA Change: P208T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: P208T

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110333
AA Change: P208T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: P208T

DomainStartEndE-ValueType
Pfam:Apc1 149 227 1.7e-22 PFAM
low complexity region 323 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,340,433 (GRCm39) I53L probably benign Het
Acss2 T C 2: 155,363,961 (GRCm39) L80P possibly damaging Het
Adam3 A T 8: 25,184,363 (GRCm39) F546I probably benign Het
Adtrp A T 13: 41,981,617 (GRCm39) probably null Het
Ankrd33 A G 15: 101,017,430 (GRCm39) K281R probably benign Het
Bcl11b A G 12: 107,955,766 (GRCm39) S128P probably benign Het
Ccdc57 T C 11: 120,794,200 (GRCm39) K265E possibly damaging Het
Cep72 A G 13: 74,199,699 (GRCm39) C244R probably benign Het
Cope A G 8: 70,765,537 (GRCm39) Q303R probably benign Het
Cpd T A 11: 76,704,420 (GRCm39) N398I probably damaging Het
Cplx1 C T 5: 108,696,393 (GRCm39) probably null Het
Dixdc1 T A 9: 50,601,214 (GRCm39) E344D possibly damaging Het
Dock7 A T 4: 98,833,445 (GRCm39) F1951I unknown Het
Ell2 C A 13: 75,910,006 (GRCm39) L119M probably damaging Het
Faap24 A T 7: 35,094,527 (GRCm39) I91K possibly damaging Het
Fubp3 T C 2: 31,485,306 (GRCm39) S107P probably damaging Het
Gas2l2 T A 11: 83,313,893 (GRCm39) Q473L probably benign Het
Ghr A T 15: 3,362,873 (GRCm39) Y200N probably damaging Het
Gm4950 G A 18: 51,998,521 (GRCm39) Q145* probably null Het
Gm826 C T 2: 160,153,810 (GRCm39) V78I unknown Het
Gnas G A 2: 174,126,842 (GRCm39) E126K probably damaging Het
Grip2 A T 6: 91,761,689 (GRCm39) V235E probably benign Het
Hmgcl A G 4: 135,681,178 (GRCm39) H88R probably benign Het
Htr7 A G 19: 36,034,283 (GRCm39) V124A probably damaging Het
Igf2r T A 17: 12,933,003 (GRCm39) I840F possibly damaging Het
Ints8 T C 4: 11,204,574 (GRCm39) I961V possibly damaging Het
Jmy A T 13: 93,590,439 (GRCm39) S555T probably benign Het
Klk1b27 G A 7: 43,705,977 (GRCm39) G227S probably damaging Het
Lao1 A C 4: 118,825,382 (GRCm39) T401P probably damaging Het
Lrwd1 C T 5: 136,152,511 (GRCm39) V547I probably benign Het
Mttp C A 3: 137,813,034 (GRCm39) R532L possibly damaging Het
Muc16 T C 9: 18,566,946 (GRCm39) T1858A unknown Het
Myo18a T A 11: 77,733,387 (GRCm39) D1409E probably benign Het
Ncor2 T A 5: 125,126,430 (GRCm39) R554* probably null Het
Or14j6 T A 17: 38,214,718 (GRCm39) Y94N possibly damaging Het
Or1e1b-ps1 A T 11: 73,845,975 (GRCm39) H153L probably benign Het
Or2b11 T C 11: 59,461,835 (GRCm39) T244A probably damaging Het
Or2l13b T A 16: 19,348,855 (GRCm39) I272F possibly damaging Het
Or52b1 A G 7: 104,978,475 (GRCm39) M308T probably benign Het
Prkar2b A G 12: 32,022,147 (GRCm39) Y213H probably damaging Het
Prkd3 T A 17: 79,282,236 (GRCm39) K306* probably null Het
Psd2 A G 18: 36,143,737 (GRCm39) E681G probably benign Het
Sel1l2 T A 2: 140,105,362 (GRCm39) N276I probably damaging Het
Smox C T 2: 131,364,031 (GRCm39) A45V possibly damaging Het
Smyd1 A G 6: 71,214,359 (GRCm39) V214A probably damaging Het
Spag5 T C 11: 78,195,868 (GRCm39) probably null Het
Trem3 C T 17: 48,556,909 (GRCm39) R127W probably damaging Het
Ttn G A 2: 76,748,425 (GRCm39) T4208I probably benign Het
Tubgcp6 A G 15: 89,004,839 (GRCm39) F260S probably damaging Het
Vmn1r51 A T 6: 90,106,654 (GRCm39) D190V probably benign Het
Zc3h14 A G 12: 98,724,859 (GRCm39) I174V possibly damaging Het
Zfp423 G A 8: 88,509,060 (GRCm39) T428I probably benign Het
Zfp608 T A 18: 55,030,454 (GRCm39) N1162I possibly damaging Het
Zmym5 T C 14: 57,042,255 (GRCm39) M8V probably benign Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128,487,050 (GRCm39) splice site probably benign
IGL00704:Anapc1 APN 2 128,505,904 (GRCm39) missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128,471,649 (GRCm39) missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128,475,328 (GRCm39) missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128,495,090 (GRCm39) missense probably benign
IGL02089:Anapc1 APN 2 128,505,853 (GRCm39) missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128,501,772 (GRCm39) missense probably benign
IGL02570:Anapc1 APN 2 128,487,120 (GRCm39) missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128,465,851 (GRCm39) missense probably benign 0.02
IGL02726:Anapc1 APN 2 128,501,705 (GRCm39) missense probably benign 0.05
IGL03265:Anapc1 APN 2 128,469,117 (GRCm39) missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128,469,033 (GRCm39) splice site probably benign
IGL03327:Anapc1 APN 2 128,465,854 (GRCm39) missense probably benign 0.00
R0023:Anapc1 UTSW 2 128,520,138 (GRCm39) missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128,483,431 (GRCm39) missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128,483,431 (GRCm39) missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128,465,886 (GRCm39) splice site probably benign
R0103:Anapc1 UTSW 2 128,522,372 (GRCm39) splice site probably benign
R0103:Anapc1 UTSW 2 128,522,372 (GRCm39) splice site probably benign
R0109:Anapc1 UTSW 2 128,476,613 (GRCm39) missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128,476,613 (GRCm39) missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128,470,549 (GRCm39) missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128,470,549 (GRCm39) missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128,476,631 (GRCm39) missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128,483,260 (GRCm39) critical splice donor site probably null
R0467:Anapc1 UTSW 2 128,510,963 (GRCm39) missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128,474,575 (GRCm39) missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128,461,252 (GRCm39) missense probably benign 0.17
R0919:Anapc1 UTSW 2 128,459,651 (GRCm39) missense probably benign
R1175:Anapc1 UTSW 2 128,522,108 (GRCm39) missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128,459,617 (GRCm39) missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128,459,476 (GRCm39) missense probably benign 0.44
R1556:Anapc1 UTSW 2 128,466,819 (GRCm39) missense probably benign 0.00
R1567:Anapc1 UTSW 2 128,459,636 (GRCm39) missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128,470,452 (GRCm39) missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128,500,166 (GRCm39) critical splice donor site probably null
R1677:Anapc1 UTSW 2 128,518,128 (GRCm39) missense probably benign 0.09
R1854:Anapc1 UTSW 2 128,517,810 (GRCm39) missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128,501,708 (GRCm39) missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128,475,335 (GRCm39) missense probably benign 0.36
R1984:Anapc1 UTSW 2 128,511,608 (GRCm39) missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128,490,378 (GRCm39) missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128,484,468 (GRCm39) missense probably benign 0.23
R2928:Anapc1 UTSW 2 128,522,057 (GRCm39) missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128,484,602 (GRCm39) missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128,484,439 (GRCm39) missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128,469,149 (GRCm39) intron probably benign
R4359:Anapc1 UTSW 2 128,465,476 (GRCm39) missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128,518,169 (GRCm39) critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128,469,115 (GRCm39) missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128,505,925 (GRCm39) missense probably benign 0.05
R4770:Anapc1 UTSW 2 128,527,980 (GRCm39) splice site probably benign
R4824:Anapc1 UTSW 2 128,470,610 (GRCm39) missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128,526,514 (GRCm39) missense probably benign 0.23
R5016:Anapc1 UTSW 2 128,449,095 (GRCm39) unclassified probably benign
R5063:Anapc1 UTSW 2 128,471,469 (GRCm39) missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128,501,837 (GRCm39) missense probably benign
R5271:Anapc1 UTSW 2 128,527,905 (GRCm39) nonsense probably null
R5363:Anapc1 UTSW 2 128,492,114 (GRCm39) critical splice donor site probably null
R5469:Anapc1 UTSW 2 128,517,621 (GRCm39) nonsense probably null
R5473:Anapc1 UTSW 2 128,449,115 (GRCm39) unclassified probably benign
R5559:Anapc1 UTSW 2 128,522,354 (GRCm39) nonsense probably null
R5631:Anapc1 UTSW 2 128,499,137 (GRCm39) missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128,466,836 (GRCm39) missense probably benign 0.19
R5840:Anapc1 UTSW 2 128,448,957 (GRCm39) unclassified probably benign
R6226:Anapc1 UTSW 2 128,492,292 (GRCm39) missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128,514,055 (GRCm39) nonsense probably null
R6561:Anapc1 UTSW 2 128,505,919 (GRCm39) missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128,526,454 (GRCm39) nonsense probably null
R6799:Anapc1 UTSW 2 128,501,657 (GRCm39) missense probably null 0.38
R6887:Anapc1 UTSW 2 128,501,688 (GRCm39) missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128,511,820 (GRCm39) missense probably benign 0.06
R7011:Anapc1 UTSW 2 128,490,601 (GRCm39) splice site probably null
R7041:Anapc1 UTSW 2 128,470,576 (GRCm39) missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128,457,350 (GRCm39) missense probably damaging 0.96
R7109:Anapc1 UTSW 2 128,516,522 (GRCm39) missense probably benign 0.33
R7123:Anapc1 UTSW 2 128,454,930 (GRCm39) missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128,516,604 (GRCm39) missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128,483,457 (GRCm39) missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128,526,528 (GRCm39) missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128,511,828 (GRCm39) missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128,516,513 (GRCm39) missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128,490,408 (GRCm39) missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128,474,547 (GRCm39) missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128,461,837 (GRCm39) nonsense probably null
R8402:Anapc1 UTSW 2 128,472,148 (GRCm39) missense probably benign 0.02
R8422:Anapc1 UTSW 2 128,517,757 (GRCm39) missense probably benign
R8425:Anapc1 UTSW 2 128,511,788 (GRCm39) missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128,500,264 (GRCm39) splice site probably null
R8553:Anapc1 UTSW 2 128,461,833 (GRCm39) missense possibly damaging 0.80
R8688:Anapc1 UTSW 2 128,527,748 (GRCm39) missense probably benign 0.19
R8699:Anapc1 UTSW 2 128,483,373 (GRCm39) missense probably damaging 1.00
R8719:Anapc1 UTSW 2 128,483,369 (GRCm39) missense probably damaging 1.00
R8775:Anapc1 UTSW 2 128,499,093 (GRCm39) missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128,499,093 (GRCm39) missense possibly damaging 0.92
R8806:Anapc1 UTSW 2 128,464,333 (GRCm39) missense possibly damaging 0.67
R8973:Anapc1 UTSW 2 128,505,952 (GRCm39) missense probably damaging 0.99
R8977:Anapc1 UTSW 2 128,483,322 (GRCm39) missense probably damaging 1.00
R9000:Anapc1 UTSW 2 128,476,628 (GRCm39) missense probably damaging 1.00
R9080:Anapc1 UTSW 2 128,464,426 (GRCm39) missense possibly damaging 0.82
R9203:Anapc1 UTSW 2 128,465,422 (GRCm39) missense possibly damaging 0.66
R9314:Anapc1 UTSW 2 128,464,420 (GRCm39) missense possibly damaging 0.69
R9386:Anapc1 UTSW 2 128,459,642 (GRCm39) missense probably benign 0.08
R9415:Anapc1 UTSW 2 128,476,598 (GRCm39) missense probably benign
R9436:Anapc1 UTSW 2 128,518,045 (GRCm39) missense probably benign
R9516:Anapc1 UTSW 2 128,517,633 (GRCm39) missense possibly damaging 0.77
R9563:Anapc1 UTSW 2 128,505,980 (GRCm39) nonsense probably null
R9572:Anapc1 UTSW 2 128,505,976 (GRCm39) missense probably benign
R9757:Anapc1 UTSW 2 128,517,676 (GRCm39) missense probably damaging 1.00
R9766:Anapc1 UTSW 2 128,500,221 (GRCm39) missense probably damaging 1.00
X0066:Anapc1 UTSW 2 128,516,621 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCTTGGCTTTGCTGAGATAAC -3'
(R):5'- GGCTCTGTACATCTTGGCAG -3'

Sequencing Primer
(F):5'- GCTGAGATAACTGTTGTTCTTGC -3'
(R):5'- AAGACCCTGTTTTCTCAAAGGC -3'
Posted On 2019-05-15