Incidental Mutation 'R7075:Eif2ak4'
ID549146
Institutional Source Beutler Lab
Gene Symbol Eif2ak4
Ensembl Gene ENSMUSG00000005102
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 4
SynonymsGCN2
MMRRC Submission
Accession Numbers

MGI: 1353427

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7075 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location118388618-118475234 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 118420810 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 318 (Q318*)
Ref Sequence ENSEMBL: ENSMUSP00000005233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005233] [ENSMUST00000102527] [ENSMUST00000110870] [ENSMUST00000110872] [ENSMUST00000110874] [ENSMUST00000110877]
Predicted Effect probably null
Transcript: ENSMUST00000005233
AA Change: Q318*
SMART Domains Protein: ENSMUSP00000005233
Gene: ENSMUSG00000005102
AA Change: Q318*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RWD 25 137 3.42e-38 SMART
coiled coil region 146 205 N/A INTRINSIC
Pfam:Pkinase 323 538 4.6e-27 PFAM
Pfam:Pkinase_Tyr 326 535 5.5e-18 PFAM
Pfam:Pkinase 589 663 1.7e-11 PFAM
Pfam:Pkinase_Tyr 589 663 1.2e-5 PFAM
low complexity region 728 738 N/A INTRINSIC
Pfam:Pkinase 781 1000 2.6e-38 PFAM
Pfam:Pkinase_Tyr 786 998 1.8e-18 PFAM
Pfam:tRNA-synt_His 1054 1380 5.7e-18 PFAM
Pfam:HGTP_anticodon2 1392 1647 5.8e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102527
AA Change: Q206*
SMART Domains Protein: ENSMUSP00000099586
Gene: ENSMUSG00000005102
AA Change: Q206*

DomainStartEndE-ValueType
coiled coil region 34 93 N/A INTRINSIC
Pfam:Pkinase 211 426 1.6e-22 PFAM
Pfam:Pkinase_Tyr 215 423 6.8e-18 PFAM
Pfam:Pkinase_Tyr 477 551 1.2e-5 PFAM
Pfam:Pkinase 477 552 3.9e-11 PFAM
low complexity region 616 626 N/A INTRINSIC
Pfam:Pkinase 647 888 9.4e-42 PFAM
Pfam:Pkinase_Tyr 672 886 1.4e-19 PFAM
Pfam:tRNA-synt_His 941 1268 4.8e-19 PFAM
Pfam:HGTP_anticodon2 1280 1535 1e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110870
AA Change: Q40*
SMART Domains Protein: ENSMUSP00000106494
Gene: ENSMUSG00000005102
AA Change: Q40*

DomainStartEndE-ValueType
Pfam:Pkinase 45 260 3.3e-22 PFAM
Pfam:Pkinase_Tyr 47 257 1.3e-17 PFAM
Pfam:Pkinase_Tyr 311 385 2.5e-5 PFAM
Pfam:Pkinase 311 386 8e-11 PFAM
low complexity region 450 460 N/A INTRINSIC
Pfam:Pkinase 481 722 1.9e-41 PFAM
Pfam:Pkinase_Tyr 506 720 2.8e-19 PFAM
Pfam:tRNA-synt_His 775 1102 8.7e-19 PFAM
Pfam:HGTP_anticodon2 1114 1369 1.9e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110872
AA Change: Q197*
SMART Domains Protein: ENSMUSP00000106496
Gene: ENSMUSG00000005102
AA Change: Q197*

DomainStartEndE-ValueType
coiled coil region 25 84 N/A INTRINSIC
Pfam:Pkinase 202 417 3.8e-22 PFAM
Pfam:Pkinase_Tyr 206 414 1.6e-17 PFAM
Pfam:Pkinase_Tyr 468 542 2.8e-5 PFAM
Pfam:Pkinase 468 543 9.1e-11 PFAM
low complexity region 607 617 N/A INTRINSIC
Pfam:Pkinase 638 879 2.2e-41 PFAM
Pfam:Pkinase_Tyr 663 877 3.3e-19 PFAM
Pfam:tRNA-synt_His 932 1259 1.1e-18 PFAM
Pfam:HGTP_anticodon2 1271 1526 2.2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110874
AA Change: Q240*
SMART Domains Protein: ENSMUSP00000106498
Gene: ENSMUSG00000005102
AA Change: Q240*

DomainStartEndE-ValueType
Pfam:RWD 8 56 6.4e-8 PFAM
coiled coil region 68 127 N/A INTRINSIC
Pfam:Pkinase 245 460 1.1e-22 PFAM
Pfam:Pkinase_Tyr 247 457 4.2e-18 PFAM
Pfam:Pkinase_Tyr 511 585 7.8e-6 PFAM
Pfam:Pkinase 511 586 2.5e-11 PFAM
low complexity region 650 660 N/A INTRINSIC
Pfam:Pkinase 681 922 6.2e-42 PFAM
Pfam:Pkinase_Tyr 706 920 9.3e-20 PFAM
Pfam:tRNA-synt_His 975 1302 3.8e-19 PFAM
Pfam:HGTP_anticodon2 1314 1569 5.4e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110877
AA Change: Q318*
SMART Domains Protein: ENSMUSP00000106501
Gene: ENSMUSG00000005102
AA Change: Q318*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RWD 25 137 3.42e-38 SMART
coiled coil region 146 205 N/A INTRINSIC
Pfam:Pkinase 323 538 2.6e-23 PFAM
Pfam:Pkinase_Tyr 327 535 1.1e-18 PFAM
Meta Mutation Damage Score 0.602 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (60/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a null allele have altered feeding behavior, synaptic plasticity and dendritic cell function. Homozygotes for another null allele show enhanced muscle loss and morbidity after amino acid deprivation. Homozygotes for an ENU-induced allele show higher susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(4) Chemically induced(1)
 

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp1 A T 12: 85,279,008 H72Q unknown Het
Afmid T A 11: 117,835,705 D218E probably benign Het
Ankhd1 T C 18: 36,559,989 V1A Het
Atf7ip T C 6: 136,596,515 probably null Het
BC024139 C T 15: 76,124,399 V326I probably benign Het
Bfsp1 T A 2: 143,848,965 Q159L probably damaging Het
Cct2 A T 10: 117,061,465 W125R unknown Het
Cnksr3 G T 10: 7,152,931 T147K probably benign Het
Colq C G 14: 31,552,909 G101R probably damaging Het
Dlg5 G T 14: 24,177,797 T352K possibly damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ebna1bp2 T C 4: 118,622,102 V119A probably benign Het
Eif2b1 G A 5: 124,571,251 T286M probably damaging Het
Fam53b G T 7: 132,759,623 D225E probably damaging Het
Fh1 A G 1: 175,607,855 I354T probably benign Het
Fnbp1 T C 2: 31,058,914 H206R probably benign Het
Gabrg3 A T 7: 57,323,696 D74E probably damaging Het
Galnt18 A T 7: 111,556,388 V246E possibly damaging Het
Glt6d1 T C 2: 25,795,280 R44G probably benign Het
Gm17087 T C 17: 8,566,803 M23V probably benign Het
Gpr160 A T 3: 30,896,777 I333L possibly damaging Het
Hars T C 18: 36,772,355 N142S possibly damaging Het
Hmgcll1 T C 9: 76,056,552 V97A possibly damaging Het
Itih4 T G 14: 30,892,603 V474G probably damaging Het
Keap1 C T 9: 21,231,256 V568I probably benign Het
Kifc5b A G 17: 26,925,898 M633V probably benign Het
Lsm4 A G 8: 70,677,785 E18G probably damaging Het
Meox1 T A 11: 101,893,743 Q88L probably damaging Het
Mettl25 T C 10: 105,829,924 N147S possibly damaging Het
Mphosph9 A C 5: 124,320,859 W83G probably damaging Het
Olfr1006 T A 2: 85,674,824 Y109F Het
Olfr1098 T G 2: 86,922,646 K295N possibly damaging Het
Olfr344 T C 2: 36,569,180 I194T probably benign Het
Olfr862 T A 9: 19,884,063 M81L probably benign Het
Olfr878 T C 9: 37,919,074 V139A probably benign Het
Olfr992 T C 2: 85,400,200 D111G probably damaging Het
Otogl G T 10: 107,778,929 T1954K probably benign Het
Padi2 T C 4: 140,933,217 V336A probably damaging Het
Phf21a C T 2: 92,360,379 Q675* probably null Het
Ppip5k1 T C 2: 121,321,750 E1092G probably damaging Het
Psg21 T C 7: 18,654,861 N102S probably damaging Het
Ralgapa1 C A 12: 55,820,723 Q15H possibly damaging Het
Rbm26 A T 14: 105,160,607 D26E unknown Het
Rbp4 T C 19: 38,124,061 Y152C probably damaging Het
Recql4 A G 15: 76,706,424 V646A possibly damaging Het
Rnf220 A T 4: 117,285,882 M63K probably benign Het
Selenok T C 14: 29,970,067 S21P probably damaging Het
Senp1 A G 15: 98,058,326 V404A probably benign Het
Sh3yl1 A G 12: 30,940,166 probably null Het
Snx32 A G 19: 5,496,990 L275P probably damaging Het
Ssfa2 T A 2: 79,635,660 S41T probably damaging Het
Stat5a T C 11: 100,879,693 V519A possibly damaging Het
Tbc1d10b A T 7: 127,203,238 V388E possibly damaging Het
Tdrd6 A G 17: 43,625,174 V1661A probably benign Het
Tmem63a T A 1: 180,961,149 F350L probably damaging Het
Trio A T 15: 27,898,000 I401K unknown Het
Ttn T C 2: 76,716,829 E32291G probably damaging Het
Tubgcp5 G T 7: 55,829,407 V1002L probably benign Het
Vav3 C T 3: 109,525,924 T410I possibly damaging Het
Vmn1r1 A T 1: 182,158,032 F23I probably benign Het
Vmn2r84 T A 10: 130,391,072 Q299L probably damaging Het
Vmn2r85 T A 10: 130,422,688 E499D probably benign Het
Other mutations in Eif2ak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Eif2ak4 APN 2 118464055 missense probably damaging 1.00
IGL00806:Eif2ak4 APN 2 118441166 missense probably benign 0.08
IGL01343:Eif2ak4 APN 2 118422089 missense probably benign 0.00
IGL01796:Eif2ak4 APN 2 118446304 missense probably benign 0.10
IGL02263:Eif2ak4 APN 2 118461778 missense probably benign 0.00
IGL02391:Eif2ak4 APN 2 118420791 missense probably benign 0.19
IGL02516:Eif2ak4 APN 2 118436254 missense probably damaging 1.00
IGL02603:Eif2ak4 APN 2 118450326 missense probably damaging 1.00
IGL02731:Eif2ak4 APN 2 118388814 missense probably benign
IGL02928:Eif2ak4 APN 2 118472687 critical splice donor site probably null
IGL02947:Eif2ak4 APN 2 118431033 missense probably benign 0.00
IGL03191:Eif2ak4 APN 2 118422212 missense probably damaging 1.00
IGL03202:Eif2ak4 APN 2 118400620 missense probably damaging 1.00
IGL03235:Eif2ak4 APN 2 118443140 missense probably damaging 1.00
IGL03375:Eif2ak4 APN 2 118422318 missense probably benign 0.08
absurdum UTSW 2 118420810 nonsense probably null
ad UTSW 2 118436241 missense probably damaging 1.00
atchoum UTSW 2 118400653 splice site probably benign
reductio UTSW 2 118436158 splice site probably null
PIT4520001:Eif2ak4 UTSW 2 118462327 missense probably damaging 1.00
R0023:Eif2ak4 UTSW 2 118462721 missense probably damaging 1.00
R0358:Eif2ak4 UTSW 2 118463929 intron probably null
R0482:Eif2ak4 UTSW 2 118462347 missense probably damaging 1.00
R0505:Eif2ak4 UTSW 2 118431036 missense probably benign 0.01
R0523:Eif2ak4 UTSW 2 118442096 critical splice donor site probably null
R0578:Eif2ak4 UTSW 2 118474991 splice site probably benign
R0615:Eif2ak4 UTSW 2 118436185 missense probably damaging 1.00
R1300:Eif2ak4 UTSW 2 118463983 missense possibly damaging 0.79
R1531:Eif2ak4 UTSW 2 118443210 missense probably damaging 1.00
R1777:Eif2ak4 UTSW 2 118430839 missense probably damaging 0.98
R1866:Eif2ak4 UTSW 2 118472661 missense probably damaging 1.00
R1932:Eif2ak4 UTSW 2 118448486 missense probably damaging 1.00
R1977:Eif2ak4 UTSW 2 118461757 nonsense probably null
R2011:Eif2ak4 UTSW 2 118430947 missense probably damaging 1.00
R2046:Eif2ak4 UTSW 2 118451408 splice site probably benign
R2122:Eif2ak4 UTSW 2 118455793 missense probably damaging 1.00
R2125:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2126:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2193:Eif2ak4 UTSW 2 118422266 missense probably benign 0.12
R2259:Eif2ak4 UTSW 2 118455783 missense probably damaging 0.97
R2513:Eif2ak4 UTSW 2 118426583 missense probably damaging 1.00
R3798:Eif2ak4 UTSW 2 118474083 missense probably damaging 1.00
R3898:Eif2ak4 UTSW 2 118430923 missense probably damaging 1.00
R3900:Eif2ak4 UTSW 2 118475029 missense probably damaging 1.00
R4375:Eif2ak4 UTSW 2 118427924 missense probably damaging 1.00
R4423:Eif2ak4 UTSW 2 118439066 missense probably benign 0.01
R4589:Eif2ak4 UTSW 2 118417338 missense probably damaging 1.00
R4734:Eif2ak4 UTSW 2 118422087 missense probably damaging 1.00
R5173:Eif2ak4 UTSW 2 118408360 missense probably damaging 1.00
R5367:Eif2ak4 UTSW 2 118436158 splice site probably null
R5471:Eif2ak4 UTSW 2 118474132 missense probably benign 0.02
R5528:Eif2ak4 UTSW 2 118427938 missense probably damaging 1.00
R5634:Eif2ak4 UTSW 2 118462311 missense probably damaging 1.00
R5726:Eif2ak4 UTSW 2 118443132 missense probably damaging 1.00
R5756:Eif2ak4 UTSW 2 118462740 missense possibly damaging 0.95
R5779:Eif2ak4 UTSW 2 118412963 missense possibly damaging 0.85
R5807:Eif2ak4 UTSW 2 118388851 missense probably benign
R6045:Eif2ak4 UTSW 2 118388815 nonsense probably null
R6187:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R6193:Eif2ak4 UTSW 2 118400600 start gained probably benign
R6468:Eif2ak4 UTSW 2 118436241 missense probably damaging 1.00
R6555:Eif2ak4 UTSW 2 118427869 missense probably damaging 0.96
R6616:Eif2ak4 UTSW 2 118454845 nonsense probably null
R6737:Eif2ak4 UTSW 2 118462268 frame shift probably null
R6956:Eif2ak4 UTSW 2 118422267 missense probably damaging 0.96
R7109:Eif2ak4 UTSW 2 118405051 missense probably damaging 1.00
R7228:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R7441:Eif2ak4 UTSW 2 118471896 missense probably benign 0.01
R7555:Eif2ak4 UTSW 2 118417283 missense possibly damaging 0.64
R7567:Eif2ak4 UTSW 2 118450314 missense probably benign
X0061:Eif2ak4 UTSW 2 118468176 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAGGTATTGCAGTAAATGTTTC -3'
(R):5'- AGATTGGGCCTTTGGACAGC -3'

Sequencing Primer
(F):5'- CACACAGTTTACAAGCTCTG -3'
(R):5'- TCAGTTTTGAATCTAAGACAGGGGC -3'
Posted On2019-05-15