Incidental Mutation 'R0614:Tmem81'
ID54926
Institutional Source Beutler Lab
Gene Symbol Tmem81
Ensembl Gene ENSMUSG00000048174
Gene Nametransmembrane protein 81
Synonyms4930429O20Rik
MMRRC Submission 038803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.039) question?
Stock #R0614 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132506230-132508639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132507731 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 92 (V92I)
Ref Sequence ENSEMBL: ENSMUSP00000139911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027700] [ENSMUST00000058167] [ENSMUST00000086521] [ENSMUST00000187505] [ENSMUST00000188789] [ENSMUST00000190825] [ENSMUST00000190997]
Predicted Effect probably benign
Transcript: ENSMUST00000027700
SMART Domains Protein: ENSMUSP00000027700
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058167
AA Change: V92I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000062565
Gene: ENSMUSG00000048174
AA Change: V92I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:IG 86 178 6e-54 BLAST
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086521
SMART Domains Protein: ENSMUSP00000083707
Gene: ENSMUSG00000053024

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 54 120 8.78e-9 SMART
IG 142 232 3.89e-1 SMART
IGc2 254 315 2.14e-21 SMART
IGc2 341 404 4.59e-12 SMART
IGc2 433 497 7.52e-8 SMART
IGc2 523 596 2.72e-5 SMART
FN3 610 696 2.72e-12 SMART
FN3 713 799 1.02e-2 SMART
FN3 815 899 5.27e-10 SMART
FN3 915 995 8.91e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186487
Predicted Effect probably benign
Transcript: ENSMUST00000187505
SMART Domains Protein: ENSMUSP00000141176
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
Blast:WD40 1 52 9e-13 BLAST
WD40 55 99 5.1e-3 SMART
WD40 114 153 7.9e-2 SMART
WD40 156 195 1.9e-2 SMART
low complexity region 217 231 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187834
Predicted Effect probably benign
Transcript: ENSMUST00000188065
Predicted Effect probably benign
Transcript: ENSMUST00000188789
AA Change: V92I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139911
Gene: ENSMUSG00000048174
AA Change: V92I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:IG 86 178 6e-54 BLAST
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190601
Predicted Effect probably benign
Transcript: ENSMUST00000190825
SMART Domains Protein: ENSMUSP00000139519
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 1.4e-3 SMART
WD40 55 94 4.6e-9 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 5.1e-3 SMART
WD40 241 280 7.9e-2 SMART
WD40 283 322 1.9e-2 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190997
SMART Domains Protein: ENSMUSP00000141003
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,192,663 T137I probably benign Het
3110082I17Rik C T 5: 139,364,031 V88I possibly damaging Het
4930453N24Rik T A 16: 64,766,614 Q249L probably damaging Het
Akap2 C A 4: 57,856,720 A926E probably benign Het
Ap1g2 C T 14: 55,099,773 V702I probably benign Het
Armcx5 G A X: 135,746,815 E547K probably damaging Het
Asah2 C A 19: 32,016,728 V406L probably damaging Het
Atp8b1 T C 18: 64,533,587 probably benign Het
Axl C A 7: 25,774,163 R346L probably benign Het
Baz1a G A 12: 54,941,519 R282* probably null Het
Card14 A G 11: 119,322,827 N200S probably benign Het
Cdt1 A G 8: 122,568,137 T28A probably benign Het
Cep250 C T 2: 155,970,097 Q438* probably null Het
Dapk1 C A 13: 60,718,132 P181Q probably damaging Het
Dnah17 C T 11: 118,070,568 probably benign Het
Dph7 T C 2: 24,968,956 probably null Het
Edc4 A T 8: 105,889,396 D801V possibly damaging Het
Eif4g2 A G 7: 111,077,223 probably null Het
Eml2 T C 7: 19,202,591 L531P probably damaging Het
Ephb2 T C 4: 136,673,365 Y533C probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fsip2 A G 2: 82,977,533 K1399E probably benign Het
Hcls1 A G 16: 36,962,625 D446G probably damaging Het
Hif1a T A 12: 73,945,631 N787K probably damaging Het
Ints14 T C 9: 64,964,433 S18P probably benign Het
Kalrn A T 16: 33,993,670 probably benign Het
Llgl2 T A 11: 115,850,267 D502E probably damaging Het
Lrwd1 A G 5: 136,123,500 V570A probably damaging Het
Mga C G 2: 119,964,466 P2877R probably damaging Het
Mvd T C 8: 122,436,553 I313V probably benign Het
Myo15b C A 11: 115,882,913 P270T probably damaging Het
Naip1 C A 13: 100,444,200 V180L probably benign Het
Ofd1 T C X: 166,435,540 probably benign Het
Olfr1233 T A 2: 89,339,985 I106F probably damaging Het
Olfr1423 A T 19: 12,036,565 M59K possibly damaging Het
Olfr348 T A 2: 36,786,693 L56H probably damaging Het
Otogl G A 10: 107,798,355 P1420S probably benign Het
Pcnt C T 10: 76,420,316 V697M probably damaging Het
Plekha7 A T 7: 116,154,645 Y702* probably null Het
Plxnb3 A G X: 73,764,358 probably benign Het
Ptgis A G 2: 167,206,882 F405L probably damaging Het
Ptprk C T 10: 28,075,136 P19L probably damaging Het
Ptprt A G 2: 161,812,120 V530A possibly damaging Het
Rasgrp4 A T 7: 29,145,851 Y299F probably damaging Het
Slc39a11 T A 11: 113,523,626 probably null Het
Slc6a15 T A 10: 103,404,352 L312* probably null Het
Slf1 T A 13: 77,049,114 M794L probably benign Het
Sntg2 G A 12: 30,257,978 T236I possibly damaging Het
Stau1 T C 2: 166,950,806 Y413C probably damaging Het
Syne2 T G 12: 75,912,353 probably null Het
Tas2r104 A T 6: 131,685,202 N181K probably damaging Het
Trap1 A G 16: 4,060,751 probably benign Het
Trip12 T C 1: 84,757,761 E905G probably damaging Het
Usp2 C T 9: 44,092,492 R494* probably null Het
Vps13a G T 19: 16,652,694 R2692S probably damaging Het
Zfhx3 T C 8: 108,948,539 S2074P probably benign Het
Zfhx3 C G 8: 108,948,967 Y2216* probably null Het
Zfp423 A G 8: 87,782,114 F409S probably damaging Het
Zfp472 G A 17: 32,977,934 E328K possibly damaging Het
Zfp619 T A 7: 39,537,675 M1043K possibly damaging Het
Zfp940 T C 7: 29,846,246 I79V probably benign Het
Other mutations in Tmem81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01918:Tmem81 APN 1 132507960 missense probably damaging 1.00
R0094:Tmem81 UTSW 1 132508049 missense probably benign 0.00
R0255:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0432:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0531:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0532:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0551:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0651:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0696:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0973:Tmem81 UTSW 1 132507924 missense probably damaging 1.00
R1663:Tmem81 UTSW 1 132507897 missense probably benign 0.05
R1750:Tmem81 UTSW 1 132507583 missense probably damaging 0.98
R1881:Tmem81 UTSW 1 132508210 unclassified probably benign
R2074:Tmem81 UTSW 1 132507906 missense probably damaging 0.98
R2121:Tmem81 UTSW 1 132508109 missense probably benign 0.00
R3003:Tmem81 UTSW 1 132508014 missense probably benign 0.38
R3789:Tmem81 UTSW 1 132508071 missense probably benign 0.03
R4638:Tmem81 UTSW 1 132508205 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGACACTGGACATCCCTGAGGAG -3'
(R):5'- AGCTGCACGTCACATCGATACG -3'

Sequencing Primer
(F):5'- TCCCTGAGGAGCTACAAAAAG -3'
(R):5'- GATACGTCCCAGCGTTATACTCATAG -3'
Posted On2013-07-11