Incidental Mutation 'R7077:Heatr1'
ID549291
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene NameHEAT repeat containing 1
SynonymsB130016L12Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R7077 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location12395027-12440289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12418164 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1132 (F1132L)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059270
AA Change: F1132L

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: F1132L

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12406037 missense probably benign 0.14
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2119:Heatr1 UTSW 13 12432646 missense probably null 1.00
R2121:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12435121 missense probably benign 0.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4797:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R4954:Heatr1 UTSW 13 12407516 critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5483:Heatr1 UTSW 13 12398914 missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12406619 missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5836:Heatr1 UTSW 13 12408736 missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R6922:Heatr1 UTSW 13 12435075 missense probably benign 0.00
R7297:Heatr1 UTSW 13 12421060 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACGGATTCCCAAAAGTTCTTC -3'
(R):5'- CTTGTTAACAGTGAAATCTGATCCC -3'

Sequencing Primer
(F):5'- GCTCCACCTGTGCGTATG -3'
(R):5'- CAGTGAAATCTGATCCCAAAGG -3'
Posted On2019-05-15