Incidental Mutation 'R7078:Prrc2b'
ID549314
Institutional Source Beutler Lab
Gene Symbol Prrc2b
Ensembl Gene ENSMUSG00000039262
Gene Nameproline-rich coiled-coil 2B
Synonyms5830434P21Rik, Bat2l
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7078 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location32151082-32234537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32213519 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1003 (D1003V)
Ref Sequence ENSEMBL: ENSMUSP00000064892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036691] [ENSMUST00000069817]
Predicted Effect probably benign
Transcript: ENSMUST00000036691
SMART Domains Protein: ENSMUSP00000035734
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
Pfam:BAT2_N 1 194 2.7e-85 PFAM
low complexity region 359 374 N/A INTRINSIC
low complexity region 388 394 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
coiled coil region 494 544 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 638 656 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1112 1126 N/A INTRINSIC
low complexity region 1218 1233 N/A INTRINSIC
low complexity region 1257 1275 N/A INTRINSIC
low complexity region 1402 1421 N/A INTRINSIC
low complexity region 1425 1437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069817
AA Change: D1003V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000064892
Gene: ENSMUSG00000039262
AA Change: D1003V

DomainStartEndE-ValueType
Pfam:BAT2_N 1 191 3.1e-65 PFAM
low complexity region 359 374 N/A INTRINSIC
low complexity region 388 394 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
coiled coil region 494 544 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 638 656 N/A INTRINSIC
low complexity region 960 977 N/A INTRINSIC
low complexity region 1004 1018 N/A INTRINSIC
low complexity region 1070 1094 N/A INTRINSIC
low complexity region 1307 1325 N/A INTRINSIC
low complexity region 1388 1401 N/A INTRINSIC
low complexity region 1413 1426 N/A INTRINSIC
low complexity region 1572 1587 N/A INTRINSIC
low complexity region 1678 1693 N/A INTRINSIC
low complexity region 1798 1812 N/A INTRINSIC
low complexity region 1904 1919 N/A INTRINSIC
low complexity region 1943 1961 N/A INTRINSIC
low complexity region 2088 2107 N/A INTRINSIC
low complexity region 2111 2123 N/A INTRINSIC
low complexity region 2161 2174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128936
SMART Domains Protein: ENSMUSP00000121664
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
low complexity region 159 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132459
SMART Domains Protein: ENSMUSP00000116429
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
Pfam:BAT2_N 1 119 9.8e-24 PFAM
low complexity region 287 302 N/A INTRINSIC
low complexity region 316 322 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
coiled coil region 421 471 N/A INTRINSIC
low complexity region 528 549 N/A INTRINSIC
low complexity region 566 584 N/A INTRINSIC
low complexity region 813 828 N/A INTRINSIC
low complexity region 920 935 N/A INTRINSIC
low complexity region 1040 1054 N/A INTRINSIC
low complexity region 1146 1161 N/A INTRINSIC
low complexity region 1185 1203 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1353 1365 N/A INTRINSIC
low complexity region 1403 1416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156313
SMART Domains Protein: ENSMUSP00000114994
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
low complexity region 125 140 N/A INTRINSIC
low complexity region 231 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,410,709 N210S probably benign Het
Acaca G A 11: 84,263,312 R953Q possibly damaging Het
Aldh1a1 A T 19: 20,602,070 H20L probably benign Het
Ankrd52 T A 10: 128,383,657 C487S probably benign Het
Ap1s3 T C 1: 79,625,128 E54G probably benign Het
Arglu1 A C 8: 8,667,361 M236R probably benign Het
Baz1b T A 5: 135,217,439 F581I probably benign Het
Bbox1 T G 2: 110,292,539 D135A probably benign Het
Bcl2l14 T A 6: 134,423,823 V69E probably damaging Het
Brinp3 C T 1: 146,514,889 Q58* probably null Het
Ccnb1ip1 T A 14: 50,792,267 K113* probably null Het
Cep128 T C 12: 91,234,104 I830M probably damaging Het
Ces2f C T 8: 104,954,652 T541I probably damaging Het
Chsy3 C A 18: 59,176,077 P134Q possibly damaging Het
Cobl T G 11: 12,378,271 T112P probably damaging Het
Dcc T A 18: 71,547,398 K589I probably benign Het
Depdc1b T A 13: 108,386,971 I460K possibly damaging Het
Dlst T C 12: 85,110,931 F12S probably benign Het
Dnah1 G C 14: 31,297,110 F1342L probably damaging Het
Dtnb A G 12: 3,748,480 Q438R possibly damaging Het
Dusp4 C A 8: 34,807,911 S61R probably damaging Het
E130308A19Rik A G 4: 59,737,688 Y433C probably damaging Het
Ebf2 T C 14: 67,423,958 S512P probably benign Het
Eya1 C T 1: 14,231,412 probably null Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fzr1 T A 10: 81,368,629 D379V probably damaging Het
Gk2 T A 5: 97,456,336 E214D probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gmnc A T 16: 26,960,522 V251E probably benign Het
Golga3 A G 5: 110,193,087 Q549R probably damaging Het
Gsdmd T G 15: 75,864,355 V111G probably damaging Het
Gtf3c1 T C 7: 125,645,742 T1707A possibly damaging Het
Gucy2c C T 6: 136,697,939 V1049M probably benign Het
Gucy2g A G 19: 55,241,151 V29A probably damaging Het
Hecw1 A T 13: 14,434,459 M1K probably null Het
Hmcn1 T C 1: 150,860,367 D117G probably damaging Het
Ifnab T A 4: 88,691,113 T39S possibly damaging Het
Lcorl A G 5: 45,747,224 Y171H probably damaging Het
Ly6g6c C T 17: 35,069,461 P103L probably damaging Het
Macf1 T G 4: 123,432,143 E5189A probably damaging Het
Mapkap1 A G 2: 34,563,139 E348G probably damaging Het
Med25 G T 7: 44,884,901 A280D probably damaging Het
Mep1b C A 18: 21,100,051 A703E probably benign Het
Morn5 T A 2: 36,054,978 N71K probably benign Het
Mtmr10 T A 7: 64,320,627 Y373N possibly damaging Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ncbp1 G C 4: 46,155,756 V302L probably benign Het
Notch4 A G 17: 34,582,546 T1123A possibly damaging Het
Nudt18 T A 14: 70,579,012 M88K possibly damaging Het
Olfr1452-ps1 A T 19: 13,016,733 D170V possibly damaging Het
Olfr212 T A 6: 116,516,671 L298Q probably damaging Het
Olfr361 A G 2: 37,085,596 S51P possibly damaging Het
Olfr967 A T 9: 39,750,491 Y35F possibly damaging Het
Pdcd6ip T C 9: 113,659,885 N694S probably benign Het
Pecam1 T A 11: 106,688,947 T430S probably benign Het
Plaa T G 4: 94,574,051 T530P probably benign Het
Ppfia3 G T 7: 45,360,595 Q95K probably damaging Het
Ppp4r2 T C 6: 100,866,313 S331P probably benign Het
Prg4 T C 1: 150,458,263 T117A possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rasef T C 4: 73,780,389 I12V probably benign Het
Robo2 T G 16: 74,352,616 Y108S probably damaging Het
Rp1 T A 1: 4,206,791 E762V unknown Het
Rsg1 A T 4: 141,219,848 Y180F probably benign Het
Rsrc1 T C 3: 66,994,654 S46P unknown Het
Rttn A T 18: 89,009,422 T554S probably benign Het
Sall3 C T 18: 80,974,099 V205M probably damaging Het
Scn3a C A 2: 65,497,600 V849L probably damaging Het
Sec23a A G 12: 58,992,283 C277R probably benign Het
Sf3b3 C T 8: 110,813,007 A1075T possibly damaging Het
Sfxn5 T C 6: 85,332,384 D113G unknown Het
Slc22a22 C T 15: 57,263,480 M64I probably benign Het
Slc5a11 C T 7: 123,258,446 P253S probably damaging Het
Smarcd3 A G 5: 24,593,069 F449S probably damaging Het
Sspo C T 6: 48,460,379 T1357M probably damaging Het
Styx C T 14: 45,372,416 T179I probably benign Het
Syt7 A T 19: 10,435,599 T297S probably benign Het
Tbx19 T A 1: 165,160,566 probably benign Het
Tg T A 15: 66,673,543 V149E probably damaging Het
Tgfbr3l T A 8: 4,249,238 L35Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem219 T A 7: 126,891,803 T161S probably damaging Het
Tox2 T A 2: 163,320,581 L68H Het
Trim5 T A 7: 104,278,474 D153V possibly damaging Het
Ttn T C 2: 76,750,307 Y23414C probably damaging Het
Ttn A T 2: 76,751,809 N22913K probably damaging Het
Ubr2 A C 17: 46,955,853 M1124R possibly damaging Het
Vmn2r75 A G 7: 86,166,360 S99P probably damaging Het
Wdr83 T C 8: 85,076,051 D219G probably damaging Het
Wdr90 C T 17: 25,849,649 V1285M probably damaging Het
Zmynd15 A T 11: 70,460,755 L62F probably damaging Het
Other mutations in Prrc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Prrc2b APN 2 32208719 missense probably damaging 1.00
IGL00846:Prrc2b APN 2 32199097 splice site probably benign
IGL00977:Prrc2b APN 2 32213810 missense probably benign 0.05
IGL01372:Prrc2b APN 2 32223930 missense probably damaging 0.99
IGL01993:Prrc2b APN 2 32224045 missense possibly damaging 0.47
IGL02097:Prrc2b APN 2 32191501 splice site probably benign
IGL02165:Prrc2b APN 2 32214640 missense probably damaging 1.00
IGL02184:Prrc2b APN 2 32221455 missense probably benign 0.19
IGL02238:Prrc2b APN 2 32213417 missense probably damaging 1.00
IGL02338:Prrc2b APN 2 32214035 missense probably benign 0.01
IGL02399:Prrc2b APN 2 32226961 nonsense probably null
IGL02597:Prrc2b APN 2 32219613 missense probably damaging 1.00
IGL02729:Prrc2b APN 2 32208758 missense probably damaging 0.99
IGL02743:Prrc2b APN 2 32194429 missense probably damaging 1.00
IGL02815:Prrc2b APN 2 32204253 missense probably damaging 1.00
IGL03159:Prrc2b APN 2 32194486 missense probably damaging 0.98
FR4304:Prrc2b UTSW 2 32221167 missense probably damaging 1.00
R0082:Prrc2b UTSW 2 32212298 splice site probably benign
R0105:Prrc2b UTSW 2 32213311 nonsense probably null
R0276:Prrc2b UTSW 2 32219654 missense probably damaging 0.97
R0325:Prrc2b UTSW 2 32199091 missense probably damaging 1.00
R0436:Prrc2b UTSW 2 32230660 missense probably damaging 1.00
R0595:Prrc2b UTSW 2 32183177 missense probably damaging 1.00
R0607:Prrc2b UTSW 2 32213870 missense probably damaging 0.99
R0650:Prrc2b UTSW 2 32229255 splice site probably benign
R1282:Prrc2b UTSW 2 32223444 missense probably damaging 0.96
R1421:Prrc2b UTSW 2 32200978 missense possibly damaging 0.65
R1452:Prrc2b UTSW 2 32194985 missense probably damaging 1.00
R1535:Prrc2b UTSW 2 32204289 missense probably benign 0.06
R1709:Prrc2b UTSW 2 32194461 missense probably damaging 1.00
R1710:Prrc2b UTSW 2 32212222 missense probably damaging 0.99
R2094:Prrc2b UTSW 2 32182570 missense probably damaging 1.00
R2202:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2203:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2204:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2428:Prrc2b UTSW 2 32216055 missense probably benign 0.00
R2435:Prrc2b UTSW 2 32219729 missense probably damaging 0.99
R3439:Prrc2b UTSW 2 32206347 missense probably benign 0.01
R4175:Prrc2b UTSW 2 32218808 intron probably benign
R4710:Prrc2b UTSW 2 32193857 missense possibly damaging 0.80
R4728:Prrc2b UTSW 2 32230625 missense probably damaging 1.00
R4791:Prrc2b UTSW 2 32217339 splice site probably null
R4876:Prrc2b UTSW 2 32214200 missense probably benign 0.00
R4908:Prrc2b UTSW 2 32226318 missense possibly damaging 0.94
R4997:Prrc2b UTSW 2 32222311 missense probably damaging 1.00
R5240:Prrc2b UTSW 2 32206396 missense probably benign 0.01
R5276:Prrc2b UTSW 2 32214722 missense probably benign 0.09
R5455:Prrc2b UTSW 2 32221343 critical splice acceptor site probably null
R5821:Prrc2b UTSW 2 32212132 missense probably damaging 0.99
R5835:Prrc2b UTSW 2 32206473 missense probably benign 0.18
R5958:Prrc2b UTSW 2 32212080 missense possibly damaging 0.89
R6052:Prrc2b UTSW 2 32212285 missense possibly damaging 0.92
R6218:Prrc2b UTSW 2 32208811 missense probably damaging 1.00
R6428:Prrc2b UTSW 2 32226496 intron probably null
R6505:Prrc2b UTSW 2 32222320 missense probably damaging 1.00
R6812:Prrc2b UTSW 2 32213141 missense probably benign 0.30
R6826:Prrc2b UTSW 2 32222288 critical splice acceptor site probably null
R6827:Prrc2b UTSW 2 32200951 missense probably benign 0.37
R7021:Prrc2b UTSW 2 32221486 missense probably damaging 1.00
R7081:Prrc2b UTSW 2 32213063 missense probably benign 0.12
R7101:Prrc2b UTSW 2 32226993 missense possibly damaging 0.68
R7215:Prrc2b UTSW 2 32229297 missense probably damaging 1.00
R7228:Prrc2b UTSW 2 32214306 nonsense probably null
Z1088:Prrc2b UTSW 2 32214429 missense probably benign 0.03
Z1088:Prrc2b UTSW 2 32216732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCTTGGGAGAAGGAAGG -3'
(R):5'- GGCCTGTTCCTCATCAATGAAG -3'

Sequencing Primer
(F):5'- AGCCTGAGTGGACACCTGAG -3'
(R):5'- CTGTTCCTCATCAATGAAGATCCAG -3'
Posted On2019-05-15