Incidental Mutation 'R7078:Plaa'
ID549328
Institutional Source Beutler Lab
Gene Symbol Plaa
Ensembl Gene ENSMUSG00000028577
Gene Namephospholipase A2, activating protein
SynonymsD4Ertd618e, Ufd3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R7078 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location94567514-94603244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 94574051 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 530 (T530P)
Ref Sequence ENSEMBL: ENSMUSP00000102724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107107]
Predicted Effect probably benign
Transcript: ENSMUST00000107107
AA Change: T530P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102724
Gene: ENSMUSG00000028577
AA Change: T530P

DomainStartEndE-ValueType
WD40 7 47 4.46e-1 SMART
WD40 54 98 8.49e-3 SMART
WD40 101 139 1.72e-3 SMART
WD40 140 179 8.81e-10 SMART
WD40 180 218 3.22e-3 SMART
WD40 220 259 7.33e-7 SMART
WD40 260 298 6.79e-2 SMART
Pfam:PFU 345 459 2.3e-43 PFAM
Pfam:PUL 535 789 1.4e-69 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000116530
Gene: ENSMUSG00000028577
AA Change: T136P

DomainStartEndE-ValueType
Pfam:PFU 1 89 2.6e-34 PFAM
Pfam:PUL 142 214 7.5e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous KO is embryonic lethal. A hypomorphic homozygous point mutation affects neuromuscular junctions and Purkinje cell development, causing early-onset neurodysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,410,709 N210S probably benign Het
Acaca G A 11: 84,263,312 R953Q possibly damaging Het
Aldh1a1 A T 19: 20,602,070 H20L probably benign Het
Ankrd52 T A 10: 128,383,657 C487S probably benign Het
Ap1s3 T C 1: 79,625,128 E54G probably benign Het
Arglu1 A C 8: 8,667,361 M236R probably benign Het
Baz1b T A 5: 135,217,439 F581I probably benign Het
Bbox1 T G 2: 110,292,539 D135A probably benign Het
Bcl2l14 T A 6: 134,423,823 V69E probably damaging Het
Brinp3 C T 1: 146,514,889 Q58* probably null Het
Ccnb1ip1 T A 14: 50,792,267 K113* probably null Het
Cep128 T C 12: 91,234,104 I830M probably damaging Het
Ces2f C T 8: 104,954,652 T541I probably damaging Het
Chsy3 C A 18: 59,176,077 P134Q possibly damaging Het
Cobl T G 11: 12,378,271 T112P probably damaging Het
Dcc T A 18: 71,547,398 K589I probably benign Het
Depdc1b T A 13: 108,386,971 I460K possibly damaging Het
Dlst T C 12: 85,110,931 F12S probably benign Het
Dnah1 G C 14: 31,297,110 F1342L probably damaging Het
Dtnb A G 12: 3,748,480 Q438R possibly damaging Het
Dusp4 C A 8: 34,807,911 S61R probably damaging Het
E130308A19Rik A G 4: 59,737,688 Y433C probably damaging Het
Ebf2 T C 14: 67,423,958 S512P probably benign Het
Eya1 C T 1: 14,231,412 probably null Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fzr1 T A 10: 81,368,629 D379V probably damaging Het
Gk2 T A 5: 97,456,336 E214D probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gmnc A T 16: 26,960,522 V251E probably benign Het
Golga3 A G 5: 110,193,087 Q549R probably damaging Het
Gsdmd T G 15: 75,864,355 V111G probably damaging Het
Gtf3c1 T C 7: 125,645,742 T1707A possibly damaging Het
Gucy2c C T 6: 136,697,939 V1049M probably benign Het
Gucy2g A G 19: 55,241,151 V29A probably damaging Het
Hecw1 A T 13: 14,434,459 M1K probably null Het
Hmcn1 T C 1: 150,860,367 D117G probably damaging Het
Ifnab T A 4: 88,691,113 T39S possibly damaging Het
Lcorl A G 5: 45,747,224 Y171H probably damaging Het
Ly6g6c C T 17: 35,069,461 P103L probably damaging Het
Macf1 T G 4: 123,432,143 E5189A probably damaging Het
Mapkap1 A G 2: 34,563,139 E348G probably damaging Het
Med25 G T 7: 44,884,901 A280D probably damaging Het
Mep1b C A 18: 21,100,051 A703E probably benign Het
Morn5 T A 2: 36,054,978 N71K probably benign Het
Mtmr10 T A 7: 64,320,627 Y373N possibly damaging Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ncbp1 G C 4: 46,155,756 V302L probably benign Het
Notch4 A G 17: 34,582,546 T1123A possibly damaging Het
Nudt18 T A 14: 70,579,012 M88K possibly damaging Het
Olfr1452-ps1 A T 19: 13,016,733 D170V possibly damaging Het
Olfr212 T A 6: 116,516,671 L298Q probably damaging Het
Olfr361 A G 2: 37,085,596 S51P possibly damaging Het
Olfr967 A T 9: 39,750,491 Y35F possibly damaging Het
Pdcd6ip T C 9: 113,659,885 N694S probably benign Het
Pecam1 T A 11: 106,688,947 T430S probably benign Het
Ppfia3 G T 7: 45,360,595 Q95K probably damaging Het
Ppp4r2 T C 6: 100,866,313 S331P probably benign Het
Prg4 T C 1: 150,458,263 T117A possibly damaging Het
Prrc2b A T 2: 32,213,519 D1003V probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rasef T C 4: 73,780,389 I12V probably benign Het
Robo2 T G 16: 74,352,616 Y108S probably damaging Het
Rp1 T A 1: 4,206,791 E762V unknown Het
Rsg1 A T 4: 141,219,848 Y180F probably benign Het
Rsrc1 T C 3: 66,994,654 S46P unknown Het
Rttn A T 18: 89,009,422 T554S probably benign Het
Sall3 C T 18: 80,974,099 V205M probably damaging Het
Scn3a C A 2: 65,497,600 V849L probably damaging Het
Sec23a A G 12: 58,992,283 C277R probably benign Het
Sf3b3 C T 8: 110,813,007 A1075T possibly damaging Het
Sfxn5 T C 6: 85,332,384 D113G unknown Het
Slc22a22 C T 15: 57,263,480 M64I probably benign Het
Slc5a11 C T 7: 123,258,446 P253S probably damaging Het
Smarcd3 A G 5: 24,593,069 F449S probably damaging Het
Sspo C T 6: 48,460,379 T1357M probably damaging Het
Styx C T 14: 45,372,416 T179I probably benign Het
Syt7 A T 19: 10,435,599 T297S probably benign Het
Tbx19 T A 1: 165,160,566 probably benign Het
Tg T A 15: 66,673,543 V149E probably damaging Het
Tgfbr3l T A 8: 4,249,238 L35Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem219 T A 7: 126,891,803 T161S probably damaging Het
Tox2 T A 2: 163,320,581 L68H Het
Trim5 T A 7: 104,278,474 D153V possibly damaging Het
Ttn T C 2: 76,750,307 Y23414C probably damaging Het
Ttn A T 2: 76,751,809 N22913K probably damaging Het
Ubr2 A C 17: 46,955,853 M1124R possibly damaging Het
Vmn2r75 A G 7: 86,166,360 S99P probably damaging Het
Wdr83 T C 8: 85,076,051 D219G probably damaging Het
Wdr90 C T 17: 25,849,649 V1285M probably damaging Het
Zmynd15 A T 11: 70,460,755 L62F probably damaging Het
Other mutations in Plaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Plaa APN 4 94582607 missense probably benign 0.00
IGL01089:Plaa APN 4 94574047 missense probably benign
IGL01695:Plaa APN 4 94574037 nonsense probably null
IGL01984:Plaa APN 4 94571685 unclassified probably null
IGL02430:Plaa APN 4 94582573 missense probably benign 0.09
IGL02552:Plaa APN 4 94582480 critical splice donor site probably null
IGL03238:Plaa APN 4 94583896 missense probably benign 0.23
R1353:Plaa UTSW 4 94571689 missense possibly damaging 0.69
R2937:Plaa UTSW 4 94569459 missense probably damaging 1.00
R3076:Plaa UTSW 4 94569805 missense probably benign
R3078:Plaa UTSW 4 94569805 missense probably benign
R3801:Plaa UTSW 4 94569888 missense probably damaging 1.00
R3802:Plaa UTSW 4 94569888 missense probably damaging 1.00
R3804:Plaa UTSW 4 94569888 missense probably damaging 1.00
R3836:Plaa UTSW 4 94586922 critical splice acceptor site probably null
R4767:Plaa UTSW 4 94586258 unclassified probably benign
R4855:Plaa UTSW 4 94586408 missense probably damaging 1.00
R4978:Plaa UTSW 4 94589932 missense possibly damaging 0.81
R5284:Plaa UTSW 4 94569637 missense probably benign 0.03
R5557:Plaa UTSW 4 94584007 unclassified probably null
R5834:Plaa UTSW 4 94583469 missense probably damaging 1.00
R5856:Plaa UTSW 4 94583487 missense probably benign 0.00
R6053:Plaa UTSW 4 94589884 missense probably benign 0.00
R6145:Plaa UTSW 4 94583992 missense probably damaging 0.99
R6646:Plaa UTSW 4 94589978 missense probably benign
R7008:Plaa UTSW 4 94569349 makesense probably null
R7058:Plaa UTSW 4 94569823 nonsense probably null
R7120:Plaa UTSW 4 94582682 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCTGTTTAAGATAGGCAAATCCTGG -3'
(R):5'- GAAAAGGCCCTTTCCTAAATCTTCTTC -3'

Sequencing Primer
(F):5'- GCAAATCCTGGCATTTGGAAG -3'
(R):5'- AAATCTTCTTCCATTTCCTGAACCAG -3'
Posted On2019-05-15