Incidental Mutation 'R0614:Ptgis'
ID54935
Institutional Source Beutler Lab
Gene Symbol Ptgis
Ensembl Gene ENSMUSG00000017969
Gene Nameprostaglandin I2 (prostacyclin) synthase
SynonymsCyp8a1, Pgis, Pgi2
MMRRC Submission 038803-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0614 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167191805-167240604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 167206882 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 405 (F405L)
Ref Sequence ENSEMBL: ENSMUSP00000085357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018113] [ENSMUST00000088041]
Predicted Effect probably damaging
Transcript: ENSMUST00000018113
AA Change: F405L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018113
Gene: ENSMUSG00000017969
AA Change: F405L

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:p450 31 495 8.6e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088041
AA Change: F405L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085357
Gene: ENSMUSG00000017969
AA Change: F405L

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:p450 31 496 1.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143645
Meta Mutation Damage Score 0.394 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to prostacyclin (prostaglandin I2), a potent vasodilator and inhibitor of platelet aggregation. An imbalance of prostacyclin and its physiological antagonist thromboxane A2 contribute to the development of myocardial infarction, stroke, and atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased blood urea nitrogen and creatinine levels, thickening of the aorta with age, mildly increased blood pressure, and kidney abnormalities including cysts, fibrosis, necrosis, and renal vascular congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,192,663 T137I probably benign Het
3110082I17Rik C T 5: 139,364,031 V88I possibly damaging Het
4930453N24Rik T A 16: 64,766,614 Q249L probably damaging Het
Akap2 C A 4: 57,856,720 A926E probably benign Het
Ap1g2 C T 14: 55,099,773 V702I probably benign Het
Armcx5 G A X: 135,746,815 E547K probably damaging Het
Asah2 C A 19: 32,016,728 V406L probably damaging Het
Atp8b1 T C 18: 64,533,587 probably benign Het
Axl C A 7: 25,774,163 R346L probably benign Het
Baz1a G A 12: 54,941,519 R282* probably null Het
Card14 A G 11: 119,322,827 N200S probably benign Het
Cdt1 A G 8: 122,568,137 T28A probably benign Het
Cep250 C T 2: 155,970,097 Q438* probably null Het
Dapk1 C A 13: 60,718,132 P181Q probably damaging Het
Dnah17 C T 11: 118,070,568 probably benign Het
Dph7 T C 2: 24,968,956 probably null Het
Edc4 A T 8: 105,889,396 D801V possibly damaging Het
Eif4g2 A G 7: 111,077,223 probably null Het
Eml2 T C 7: 19,202,591 L531P probably damaging Het
Ephb2 T C 4: 136,673,365 Y533C probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fsip2 A G 2: 82,977,533 K1399E probably benign Het
Hcls1 A G 16: 36,962,625 D446G probably damaging Het
Hif1a T A 12: 73,945,631 N787K probably damaging Het
Ints14 T C 9: 64,964,433 S18P probably benign Het
Kalrn A T 16: 33,993,670 probably benign Het
Llgl2 T A 11: 115,850,267 D502E probably damaging Het
Lrwd1 A G 5: 136,123,500 V570A probably damaging Het
Mga C G 2: 119,964,466 P2877R probably damaging Het
Mvd T C 8: 122,436,553 I313V probably benign Het
Myo15b C A 11: 115,882,913 P270T probably damaging Het
Naip1 C A 13: 100,444,200 V180L probably benign Het
Ofd1 T C X: 166,435,540 probably benign Het
Olfr1233 T A 2: 89,339,985 I106F probably damaging Het
Olfr1423 A T 19: 12,036,565 M59K possibly damaging Het
Olfr348 T A 2: 36,786,693 L56H probably damaging Het
Otogl G A 10: 107,798,355 P1420S probably benign Het
Pcnt C T 10: 76,420,316 V697M probably damaging Het
Plekha7 A T 7: 116,154,645 Y702* probably null Het
Plxnb3 A G X: 73,764,358 probably benign Het
Ptprk C T 10: 28,075,136 P19L probably damaging Het
Ptprt A G 2: 161,812,120 V530A possibly damaging Het
Rasgrp4 A T 7: 29,145,851 Y299F probably damaging Het
Slc39a11 T A 11: 113,523,626 probably null Het
Slc6a15 T A 10: 103,404,352 L312* probably null Het
Slf1 T A 13: 77,049,114 M794L probably benign Het
Sntg2 G A 12: 30,257,978 T236I possibly damaging Het
Stau1 T C 2: 166,950,806 Y413C probably damaging Het
Syne2 T G 12: 75,912,353 probably null Het
Tas2r104 A T 6: 131,685,202 N181K probably damaging Het
Tmem81 G A 1: 132,507,731 V92I probably benign Het
Trap1 A G 16: 4,060,751 probably benign Het
Trip12 T C 1: 84,757,761 E905G probably damaging Het
Usp2 C T 9: 44,092,492 R494* probably null Het
Vps13a G T 19: 16,652,694 R2692S probably damaging Het
Zfhx3 T C 8: 108,948,539 S2074P probably benign Het
Zfhx3 C G 8: 108,948,967 Y2216* probably null Het
Zfp423 A G 8: 87,782,114 F409S probably damaging Het
Zfp472 G A 17: 32,977,934 E328K possibly damaging Het
Zfp619 T A 7: 39,537,675 M1043K possibly damaging Het
Zfp940 T C 7: 29,846,246 I79V probably benign Het
Other mutations in Ptgis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01562:Ptgis APN 2 167206830 missense probably damaging 1.00
IGL01859:Ptgis APN 2 167214806 critical splice donor site probably null
IGL01965:Ptgis APN 2 167208253 missense probably benign 0.00
IGL02102:Ptgis APN 2 167225447 missense probably damaging 0.99
IGL02296:Ptgis APN 2 167206737 missense probably damaging 1.00
IGL02434:Ptgis APN 2 167240342 critical splice donor site probably null
PIT4142001:Ptgis UTSW 2 167206830 missense probably damaging 1.00
R0332:Ptgis UTSW 2 167214833 missense probably damaging 0.99
R1733:Ptgis UTSW 2 167191968 unclassified probably benign
R1756:Ptgis UTSW 2 167206803 missense probably damaging 1.00
R1779:Ptgis UTSW 2 167214858 missense probably benign 0.01
R2004:Ptgis UTSW 2 167214849 missense possibly damaging 0.94
R2019:Ptgis UTSW 2 167208279 missense probably damaging 1.00
R2019:Ptgis UTSW 2 167214810 nonsense probably null
R2512:Ptgis UTSW 2 167207276 missense probably damaging 0.99
R2679:Ptgis UTSW 2 167208193 missense probably benign 0.38
R4962:Ptgis UTSW 2 167225274 critical splice donor site probably null
R5174:Ptgis UTSW 2 167203470 critical splice acceptor site probably null
R5471:Ptgis UTSW 2 167224119 missense probably benign 0.03
R5717:Ptgis UTSW 2 167208364 splice site probably benign
R7268:Ptgis UTSW 2 167206756 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAAACAGTAGAGGCATCAGGTGTCC -3'
(R):5'- TTAGTCAGCCCTGAGTGGTAACCC -3'

Sequencing Primer
(F):5'- TGCTCCAGTCATAACTCACTAATGG -3'
(R):5'- GTAACCCCCTGAGTGGTAAC -3'
Posted On2013-07-11