Incidental Mutation 'R7078:Dtnb'
ID549366
Institutional Source Beutler Lab
Gene Symbol Dtnb
Ensembl Gene ENSMUSG00000071454
Gene Namedystrobrevin, beta
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7078 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location3572381-3781796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3748480 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 438 (Q438R)
Ref Sequence ENSEMBL: ENSMUSP00000126194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077930] [ENSMUST00000101637] [ENSMUST00000164578] [ENSMUST00000164607] [ENSMUST00000173199] [ENSMUST00000173240] [ENSMUST00000173483] [ENSMUST00000173542] [ENSMUST00000173736] [ENSMUST00000174109] [ENSMUST00000174290] [ENSMUST00000174547] [ENSMUST00000174639] [ENSMUST00000174663]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077930
AA Change: Q438R

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077085
Gene: ENSMUSG00000071454
AA Change: Q438R

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.7e-40 PFAM
Pfam:EF-hand_3 144 232 1.1e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101637
AA Change: Q438R

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099161
Gene: ENSMUSG00000071454
AA Change: Q438R

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.1e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 8e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164578
AA Change: Q438R

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126194
Gene: ENSMUSG00000071454
AA Change: Q438R

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 7.9e-38 PFAM
Pfam:EF-hand_3 144 232 2.1e-33 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164607
AA Change: Q438R

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128230
Gene: ENSMUSG00000071454
AA Change: Q438R

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2.1e-40 PFAM
Pfam:EF-hand_3 144 232 1.5e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172598
AA Change: Q251R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134124
Gene: ENSMUSG00000071454
AA Change: Q251R

DomainStartEndE-ValueType
Pfam:EF-hand_3 1 46 7.7e-15 PFAM
ZnF_ZZ 51 96 3.29e-15 SMART
low complexity region 217 230 N/A INTRINSIC
coiled coil region 242 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173199
AA Change: Q438R

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134392
Gene: ENSMUSG00000071454
AA Change: Q438R

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2e-40 PFAM
Pfam:EF-hand_3 144 232 1.6e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 9e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173240
AA Change: Q408R

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133722
Gene: ENSMUSG00000071454
AA Change: Q408R

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.3e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 373 386 N/A INTRINSIC
SCOP:d1eq1a_ 404 494 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173483
SMART Domains Protein: ENSMUSP00000134390
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 61 7.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173542
SMART Domains Protein: ENSMUSP00000134036
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
coiled coil region 1 55 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173736
AA Change: Q408R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134519
Gene: ENSMUSG00000071454
AA Change: Q408R

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.3e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 373 386 N/A INTRINSIC
coiled coil region 399 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174109
SMART Domains Protein: ENSMUSP00000134151
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 132 1.1e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174290
SMART Domains Protein: ENSMUSP00000133697
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 6e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174547
AA Change: Q438R

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133927
Gene: ENSMUSG00000071454
AA Change: Q438R

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2e-40 PFAM
Pfam:EF-hand_3 144 232 1.4e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174639
SMART Domains Protein: ENSMUSP00000133601
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 123 6.9e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174663
AA Change: Q438R

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134146
Gene: ENSMUSG00000071454
AA Change: Q438R

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2.2e-40 PFAM
Pfam:EF-hand_3 144 232 1.5e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 4e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and show no obvious histological or functional abnormalities in liver and kidney. Mice homozygous for a gene trapped allele are viable, fertile and overtly normal with no significant synaptic or behavioral defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,410,709 N210S probably benign Het
Acaca G A 11: 84,263,312 R953Q possibly damaging Het
Aldh1a1 A T 19: 20,602,070 H20L probably benign Het
Ankrd52 T A 10: 128,383,657 C487S probably benign Het
Ap1s3 T C 1: 79,625,128 E54G probably benign Het
Arglu1 A C 8: 8,667,361 M236R probably benign Het
Baz1b T A 5: 135,217,439 F581I probably benign Het
Bbox1 T G 2: 110,292,539 D135A probably benign Het
Bcl2l14 T A 6: 134,423,823 V69E probably damaging Het
Brinp3 C T 1: 146,514,889 Q58* probably null Het
Ccnb1ip1 T A 14: 50,792,267 K113* probably null Het
Cep128 T C 12: 91,234,104 I830M probably damaging Het
Ces2f C T 8: 104,954,652 T541I probably damaging Het
Chsy3 C A 18: 59,176,077 P134Q possibly damaging Het
Cobl T G 11: 12,378,271 T112P probably damaging Het
Dcc T A 18: 71,547,398 K589I probably benign Het
Depdc1b T A 13: 108,386,971 I460K possibly damaging Het
Dlst T C 12: 85,110,931 F12S probably benign Het
Dnah1 G C 14: 31,297,110 F1342L probably damaging Het
Dusp4 C A 8: 34,807,911 S61R probably damaging Het
E130308A19Rik A G 4: 59,737,688 Y433C probably damaging Het
Ebf2 T C 14: 67,423,958 S512P probably benign Het
Eya1 C T 1: 14,231,412 probably null Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fzr1 T A 10: 81,368,629 D379V probably damaging Het
Gk2 T A 5: 97,456,336 E214D probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gmnc A T 16: 26,960,522 V251E probably benign Het
Golga3 A G 5: 110,193,087 Q549R probably damaging Het
Gsdmd T G 15: 75,864,355 V111G probably damaging Het
Gtf3c1 T C 7: 125,645,742 T1707A possibly damaging Het
Gucy2c C T 6: 136,697,939 V1049M probably benign Het
Gucy2g A G 19: 55,241,151 V29A probably damaging Het
Hecw1 A T 13: 14,434,459 M1K probably null Het
Hmcn1 T C 1: 150,860,367 D117G probably damaging Het
Ifnab T A 4: 88,691,113 T39S possibly damaging Het
Lcorl A G 5: 45,747,224 Y171H probably damaging Het
Ly6g6c C T 17: 35,069,461 P103L probably damaging Het
Macf1 T G 4: 123,432,143 E5189A probably damaging Het
Mapkap1 A G 2: 34,563,139 E348G probably damaging Het
Med25 G T 7: 44,884,901 A280D probably damaging Het
Mep1b C A 18: 21,100,051 A703E probably benign Het
Morn5 T A 2: 36,054,978 N71K probably benign Het
Mtmr10 T A 7: 64,320,627 Y373N possibly damaging Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ncbp1 G C 4: 46,155,756 V302L probably benign Het
Notch4 A G 17: 34,582,546 T1123A possibly damaging Het
Nudt18 T A 14: 70,579,012 M88K possibly damaging Het
Olfr1452-ps1 A T 19: 13,016,733 D170V possibly damaging Het
Olfr212 T A 6: 116,516,671 L298Q probably damaging Het
Olfr361 A G 2: 37,085,596 S51P possibly damaging Het
Olfr967 A T 9: 39,750,491 Y35F possibly damaging Het
Pdcd6ip T C 9: 113,659,885 N694S probably benign Het
Pecam1 T A 11: 106,688,947 T430S probably benign Het
Plaa T G 4: 94,574,051 T530P probably benign Het
Ppfia3 G T 7: 45,360,595 Q95K probably damaging Het
Ppp4r2 T C 6: 100,866,313 S331P probably benign Het
Prg4 T C 1: 150,458,263 T117A possibly damaging Het
Prrc2b A T 2: 32,213,519 D1003V probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rasef T C 4: 73,780,389 I12V probably benign Het
Robo2 T G 16: 74,352,616 Y108S probably damaging Het
Rp1 T A 1: 4,206,791 E762V unknown Het
Rsg1 A T 4: 141,219,848 Y180F probably benign Het
Rsrc1 T C 3: 66,994,654 S46P unknown Het
Rttn A T 18: 89,009,422 T554S probably benign Het
Sall3 C T 18: 80,974,099 V205M probably damaging Het
Scn3a C A 2: 65,497,600 V849L probably damaging Het
Sec23a A G 12: 58,992,283 C277R probably benign Het
Sf3b3 C T 8: 110,813,007 A1075T possibly damaging Het
Sfxn5 T C 6: 85,332,384 D113G unknown Het
Slc22a22 C T 15: 57,263,480 M64I probably benign Het
Slc5a11 C T 7: 123,258,446 P253S probably damaging Het
Smarcd3 A G 5: 24,593,069 F449S probably damaging Het
Sspo C T 6: 48,460,379 T1357M probably damaging Het
Styx C T 14: 45,372,416 T179I probably benign Het
Syt7 A T 19: 10,435,599 T297S probably benign Het
Tbx19 T A 1: 165,160,566 probably benign Het
Tg T A 15: 66,673,543 V149E probably damaging Het
Tgfbr3l T A 8: 4,249,238 L35Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem219 T A 7: 126,891,803 T161S probably damaging Het
Tox2 T A 2: 163,320,581 L68H Het
Trim5 T A 7: 104,278,474 D153V possibly damaging Het
Ttn T C 2: 76,750,307 Y23414C probably damaging Het
Ttn A T 2: 76,751,809 N22913K probably damaging Het
Ubr2 A C 17: 46,955,853 M1124R possibly damaging Het
Vmn2r75 A G 7: 86,166,360 S99P probably damaging Het
Wdr83 T C 8: 85,076,051 D219G probably damaging Het
Wdr90 C T 17: 25,849,649 V1285M probably damaging Het
Zmynd15 A T 11: 70,460,755 L62F probably damaging Het
Other mutations in Dtnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Dtnb APN 12 3732626 missense probably benign 0.00
IGL02269:Dtnb APN 12 3596691 missense probably damaging 1.00
IGL02710:Dtnb APN 12 3648380 missense possibly damaging 0.93
R0004:Dtnb UTSW 12 3596635 splice site probably benign
R0449:Dtnb UTSW 12 3591971 nonsense probably null
R0601:Dtnb UTSW 12 3735039 splice site probably benign
R1242:Dtnb UTSW 12 3732627 nonsense probably null
R1582:Dtnb UTSW 12 3773554 missense possibly damaging 0.78
R1719:Dtnb UTSW 12 3643936 nonsense probably null
R1960:Dtnb UTSW 12 3781190 missense probably benign 0.34
R2073:Dtnb UTSW 12 3781273 missense probably benign
R2074:Dtnb UTSW 12 3781273 missense probably benign
R3423:Dtnb UTSW 12 3591962 nonsense probably null
R3708:Dtnb UTSW 12 3589156 splice site probably null
R4788:Dtnb UTSW 12 3772699 missense probably damaging 1.00
R4816:Dtnb UTSW 12 3749505 missense probably damaging 0.99
R5086:Dtnb UTSW 12 3632942 missense probably benign 0.19
R5725:Dtnb UTSW 12 3773566 missense probably damaging 1.00
R6724:Dtnb UTSW 12 3686817 missense probably damaging 1.00
R6835:Dtnb UTSW 12 3632841 intron probably benign
R6912:Dtnb UTSW 12 3648221 critical splice acceptor site probably null
R7105:Dtnb UTSW 12 3648391 critical splice donor site probably null
X0026:Dtnb UTSW 12 3686814 missense probably damaging 1.00
X0060:Dtnb UTSW 12 3596690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAAATGTTCTGAAACTGGTGG -3'
(R):5'- CATACAGTGTACCTCCTGGTCC -3'

Sequencing Primer
(F):5'- AAATGTTCTGAAACTGGTGGTGTTTG -3'
(R):5'- GTACCTCCTGGTCCTGGGTC -3'
Posted On2019-05-15