Incidental Mutation 'R7078:Wdr90'
ID549385
Institutional Source Beutler Lab
Gene Symbol Wdr90
Ensembl Gene ENSMUSG00000073434
Gene NameWD repeat domain 90
Synonyms3230401M21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7078 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25844771-25861501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25849649 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1285 (V1285M)
Ref Sequence ENSEMBL: ENSMUSP00000078426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043897] [ENSMUST00000079461] [ENSMUST00000176923]
Predicted Effect probably benign
Transcript: ENSMUST00000043897
SMART Domains Protein: ENSMUSP00000044639
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Roc 6 122 4.1e-11 PFAM
Pfam:Ras 6 168 2.3e-18 PFAM
EFh 188 216 1.27e1 SMART
Pfam:EF_assoc_2 219 305 2.2e-35 PFAM
EFh 308 336 1.23e-1 SMART
Pfam:EF_assoc_1 341 412 1.8e-25 PFAM
Blast:AAA 416 547 7e-18 BLAST
SCOP:d1mh1__ 422 532 4e-8 SMART
transmembrane domain 595 617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079461
AA Change: V1285M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434
AA Change: V1285M

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176923
AA Change: V1267M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434
AA Change: V1267M

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,410,709 N210S probably benign Het
Acaca G A 11: 84,263,312 R953Q possibly damaging Het
Aldh1a1 A T 19: 20,602,070 H20L probably benign Het
Ankrd52 T A 10: 128,383,657 C487S probably benign Het
Ap1s3 T C 1: 79,625,128 E54G probably benign Het
Arglu1 A C 8: 8,667,361 M236R probably benign Het
Baz1b T A 5: 135,217,439 F581I probably benign Het
Bbox1 T G 2: 110,292,539 D135A probably benign Het
Bcl2l14 T A 6: 134,423,823 V69E probably damaging Het
Brinp3 C T 1: 146,514,889 Q58* probably null Het
Ccnb1ip1 T A 14: 50,792,267 K113* probably null Het
Cep128 T C 12: 91,234,104 I830M probably damaging Het
Ces2f C T 8: 104,954,652 T541I probably damaging Het
Chsy3 C A 18: 59,176,077 P134Q possibly damaging Het
Cobl T G 11: 12,378,271 T112P probably damaging Het
Dcc T A 18: 71,547,398 K589I probably benign Het
Depdc1b T A 13: 108,386,971 I460K possibly damaging Het
Dlst T C 12: 85,110,931 F12S probably benign Het
Dnah1 G C 14: 31,297,110 F1342L probably damaging Het
Dtnb A G 12: 3,748,480 Q438R possibly damaging Het
Dusp4 C A 8: 34,807,911 S61R probably damaging Het
E130308A19Rik A G 4: 59,737,688 Y433C probably damaging Het
Ebf2 T C 14: 67,423,958 S512P probably benign Het
Eya1 C T 1: 14,231,412 probably null Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fzr1 T A 10: 81,368,629 D379V probably damaging Het
Gk2 T A 5: 97,456,336 E214D probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gmnc A T 16: 26,960,522 V251E probably benign Het
Golga3 A G 5: 110,193,087 Q549R probably damaging Het
Gsdmd T G 15: 75,864,355 V111G probably damaging Het
Gtf3c1 T C 7: 125,645,742 T1707A possibly damaging Het
Gucy2c C T 6: 136,697,939 V1049M probably benign Het
Gucy2g A G 19: 55,241,151 V29A probably damaging Het
Hecw1 A T 13: 14,434,459 M1K probably null Het
Hmcn1 T C 1: 150,860,367 D117G probably damaging Het
Ifnab T A 4: 88,691,113 T39S possibly damaging Het
Lcorl A G 5: 45,747,224 Y171H probably damaging Het
Ly6g6c C T 17: 35,069,461 P103L probably damaging Het
Macf1 T G 4: 123,432,143 E5189A probably damaging Het
Mapkap1 A G 2: 34,563,139 E348G probably damaging Het
Med25 G T 7: 44,884,901 A280D probably damaging Het
Mep1b C A 18: 21,100,051 A703E probably benign Het
Morn5 T A 2: 36,054,978 N71K probably benign Het
Mtmr10 T A 7: 64,320,627 Y373N possibly damaging Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ncbp1 G C 4: 46,155,756 V302L probably benign Het
Notch4 A G 17: 34,582,546 T1123A possibly damaging Het
Nudt18 T A 14: 70,579,012 M88K possibly damaging Het
Olfr1452-ps1 A T 19: 13,016,733 D170V possibly damaging Het
Olfr212 T A 6: 116,516,671 L298Q probably damaging Het
Olfr361 A G 2: 37,085,596 S51P possibly damaging Het
Olfr967 A T 9: 39,750,491 Y35F possibly damaging Het
Pdcd6ip T C 9: 113,659,885 N694S probably benign Het
Pecam1 T A 11: 106,688,947 T430S probably benign Het
Plaa T G 4: 94,574,051 T530P probably benign Het
Ppfia3 G T 7: 45,360,595 Q95K probably damaging Het
Ppp4r2 T C 6: 100,866,313 S331P probably benign Het
Prg4 T C 1: 150,458,263 T117A possibly damaging Het
Prrc2b A T 2: 32,213,519 D1003V probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rasef T C 4: 73,780,389 I12V probably benign Het
Robo2 T G 16: 74,352,616 Y108S probably damaging Het
Rp1 T A 1: 4,206,791 E762V unknown Het
Rsg1 A T 4: 141,219,848 Y180F probably benign Het
Rsrc1 T C 3: 66,994,654 S46P unknown Het
Rttn A T 18: 89,009,422 T554S probably benign Het
Sall3 C T 18: 80,974,099 V205M probably damaging Het
Scn3a C A 2: 65,497,600 V849L probably damaging Het
Sec23a A G 12: 58,992,283 C277R probably benign Het
Sf3b3 C T 8: 110,813,007 A1075T possibly damaging Het
Sfxn5 T C 6: 85,332,384 D113G unknown Het
Slc22a22 C T 15: 57,263,480 M64I probably benign Het
Slc5a11 C T 7: 123,258,446 P253S probably damaging Het
Smarcd3 A G 5: 24,593,069 F449S probably damaging Het
Sspo C T 6: 48,460,379 T1357M probably damaging Het
Styx C T 14: 45,372,416 T179I probably benign Het
Syt7 A T 19: 10,435,599 T297S probably benign Het
Tbx19 T A 1: 165,160,566 probably benign Het
Tg T A 15: 66,673,543 V149E probably damaging Het
Tgfbr3l T A 8: 4,249,238 L35Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem219 T A 7: 126,891,803 T161S probably damaging Het
Tox2 T A 2: 163,320,581 L68H Het
Trim5 T A 7: 104,278,474 D153V possibly damaging Het
Ttn T C 2: 76,750,307 Y23414C probably damaging Het
Ttn A T 2: 76,751,809 N22913K probably damaging Het
Ubr2 A C 17: 46,955,853 M1124R possibly damaging Het
Vmn2r75 A G 7: 86,166,360 S99P probably damaging Het
Wdr83 T C 8: 85,076,051 D219G probably damaging Het
Zmynd15 A T 11: 70,460,755 L62F probably damaging Het
Other mutations in Wdr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Wdr90 APN 17 25849364 missense probably damaging 1.00
IGL01118:Wdr90 APN 17 25854687 missense probably damaging 1.00
IGL01964:Wdr90 APN 17 25848409 missense probably benign
IGL02116:Wdr90 APN 17 25859492 missense probably benign 0.12
IGL02172:Wdr90 APN 17 25850434 missense probably benign 0.22
IGL02716:Wdr90 APN 17 25857220 missense probably damaging 0.96
IGL02961:Wdr90 APN 17 25848675 nonsense probably null
IGL03229:Wdr90 APN 17 25845463 splice site probably benign
IGL03367:Wdr90 APN 17 25847791 splice site probably benign
IGL03098:Wdr90 UTSW 17 25859987 intron probably benign
R0111:Wdr90 UTSW 17 25848444 splice site probably benign
R0454:Wdr90 UTSW 17 25860049 missense probably damaging 0.96
R0457:Wdr90 UTSW 17 25860485 missense probably benign 0.00
R0488:Wdr90 UTSW 17 25848617 missense probably damaging 1.00
R0622:Wdr90 UTSW 17 25855658 missense probably damaging 1.00
R0671:Wdr90 UTSW 17 25846393 missense probably benign 0.04
R0799:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R1177:Wdr90 UTSW 17 25846054 missense possibly damaging 0.85
R1460:Wdr90 UTSW 17 25860448 missense possibly damaging 0.82
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1544:Wdr90 UTSW 17 25849310 missense possibly damaging 0.69
R2057:Wdr90 UTSW 17 25855199 missense probably benign 0.05
R2087:Wdr90 UTSW 17 25846603 missense probably damaging 1.00
R2159:Wdr90 UTSW 17 25851741 missense probably benign
R2208:Wdr90 UTSW 17 25860388 missense probably damaging 1.00
R2345:Wdr90 UTSW 17 25859162 missense probably benign 0.05
R2391:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2394:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2520:Wdr90 UTSW 17 25855352 missense probably damaging 1.00
R3798:Wdr90 UTSW 17 25850498 missense probably benign 0.01
R3979:Wdr90 UTSW 17 25859278 missense probably benign 0.00
R4111:Wdr90 UTSW 17 25849368 missense possibly damaging 0.94
R4326:Wdr90 UTSW 17 25853731 missense probably benign 0.25
R4459:Wdr90 UTSW 17 25861002 missense possibly damaging 0.95
R4697:Wdr90 UTSW 17 25855363 missense probably benign 0.03
R4735:Wdr90 UTSW 17 25859450 missense probably benign
R4907:Wdr90 UTSW 17 25860650 intron probably benign
R5070:Wdr90 UTSW 17 25846333 missense probably damaging 1.00
R5230:Wdr90 UTSW 17 25855303 missense probably benign 0.01
R5268:Wdr90 UTSW 17 25850845 missense probably damaging 1.00
R5287:Wdr90 UTSW 17 25861467 utr 5 prime probably benign
R5382:Wdr90 UTSW 17 25845598 missense probably damaging 1.00
R5511:Wdr90 UTSW 17 25845021 unclassified probably benign
R5545:Wdr90 UTSW 17 25845856 missense probably damaging 1.00
R5707:Wdr90 UTSW 17 25857192 missense probably benign 0.00
R5973:Wdr90 UTSW 17 25845133 missense probably damaging 0.99
R5973:Wdr90 UTSW 17 25846407 missense probably damaging 1.00
R6385:Wdr90 UTSW 17 25848530 missense probably damaging 1.00
R6481:Wdr90 UTSW 17 25845911 missense probably damaging 0.99
R7214:Wdr90 UTSW 17 25845393 missense probably benign 0.00
R7288:Wdr90 UTSW 17 25846312 missense probably benign 0.03
R7304:Wdr90 UTSW 17 25851506 missense probably benign 0.10
R7309:Wdr90 UTSW 17 25860702 missense probably benign 0.02
R7391:Wdr90 UTSW 17 25846528 missense probably benign 0.08
X0064:Wdr90 UTSW 17 25848563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTACTCAGGGACATATCCTG -3'
(R):5'- ACAGGTAGGACTGCAGTGTC -3'

Sequencing Primer
(F):5'- TCAGGGACATATCCTGCATGC -3'
(R):5'- TAGGGTAGGTCCTCCACAGTGAAC -3'
Posted On2019-05-15