Incidental Mutation 'R7078:Dcc'
ID549392
Institutional Source Beutler Lab
Gene Symbol Dcc
Ensembl Gene ENSMUSG00000060534
Gene Namedeleted in colorectal carcinoma
SynonymsC030036D22Rik, Igdcc1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7078 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location71258738-72351069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71547398 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 589 (K589I)
Ref Sequence ENSEMBL: ENSMUSP00000110593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073379] [ENSMUST00000114943]
Predicted Effect probably benign
Transcript: ENSMUST00000073379
AA Change: K589I

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073094
Gene: ENSMUSG00000060534
AA Change: K589I

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 824 909 2.48e-6 SMART
FN3 925 1011 1.35e-7 SMART
transmembrane domain 1079 1101 N/A INTRINSIC
Pfam:Neogenin_C 1126 1425 5.5e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114943
AA Change: K589I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110593
Gene: ENSMUSG00000060534
AA Change: K589I

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 844 929 2.48e-6 SMART
FN3 945 1031 1.35e-7 SMART
transmembrane domain 1099 1121 N/A INTRINSIC
Pfam:Neogenin_C 1148 1445 3.4e-113 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a netrin 1 receptor. The transmembrane protein is a member of the immunoglobulin superfamily of cell adhesion molecules, and mediates axon guidance of neuronal growth cones towards sources of netrin 1 ligand. The cytoplasmic tail interacts with the tyrosine kinases Src and focal adhesion kinase (FAK, also known as PTK2) to mediate axon attraction. The protein partially localizes to lipid rafts, and induces apoptosis in the absence of ligand. The protein functions as a tumor suppressor, and is frequently mutated or downregulated in colorectal cancer and esophageal carcinoma. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous animals show defects in axonal projections and hypothalamic development affecting both visual and neruoendocrine systems. Incidence of tumors increases in mutations preventing netrin-1 binding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,410,709 N210S probably benign Het
Acaca G A 11: 84,263,312 R953Q possibly damaging Het
Aldh1a1 A T 19: 20,602,070 H20L probably benign Het
Ankrd52 T A 10: 128,383,657 C487S probably benign Het
Ap1s3 T C 1: 79,625,128 E54G probably benign Het
Arglu1 A C 8: 8,667,361 M236R probably benign Het
Baz1b T A 5: 135,217,439 F581I probably benign Het
Bbox1 T G 2: 110,292,539 D135A probably benign Het
Bcl2l14 T A 6: 134,423,823 V69E probably damaging Het
Brinp3 C T 1: 146,514,889 Q58* probably null Het
Ccnb1ip1 T A 14: 50,792,267 K113* probably null Het
Cep128 T C 12: 91,234,104 I830M probably damaging Het
Ces2f C T 8: 104,954,652 T541I probably damaging Het
Chsy3 C A 18: 59,176,077 P134Q possibly damaging Het
Cobl T G 11: 12,378,271 T112P probably damaging Het
Depdc1b T A 13: 108,386,971 I460K possibly damaging Het
Dlst T C 12: 85,110,931 F12S probably benign Het
Dnah1 G C 14: 31,297,110 F1342L probably damaging Het
Dtnb A G 12: 3,748,480 Q438R possibly damaging Het
Dusp4 C A 8: 34,807,911 S61R probably damaging Het
E130308A19Rik A G 4: 59,737,688 Y433C probably damaging Het
Ebf2 T C 14: 67,423,958 S512P probably benign Het
Eya1 C T 1: 14,231,412 probably null Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fzr1 T A 10: 81,368,629 D379V probably damaging Het
Gk2 T A 5: 97,456,336 E214D probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gmnc A T 16: 26,960,522 V251E probably benign Het
Golga3 A G 5: 110,193,087 Q549R probably damaging Het
Gsdmd T G 15: 75,864,355 V111G probably damaging Het
Gtf3c1 T C 7: 125,645,742 T1707A possibly damaging Het
Gucy2c C T 6: 136,697,939 V1049M probably benign Het
Gucy2g A G 19: 55,241,151 V29A probably damaging Het
Hecw1 A T 13: 14,434,459 M1K probably null Het
Hmcn1 T C 1: 150,860,367 D117G probably damaging Het
Ifnab T A 4: 88,691,113 T39S possibly damaging Het
Lcorl A G 5: 45,747,224 Y171H probably damaging Het
Ly6g6c C T 17: 35,069,461 P103L probably damaging Het
Macf1 T G 4: 123,432,143 E5189A probably damaging Het
Mapkap1 A G 2: 34,563,139 E348G probably damaging Het
Med25 G T 7: 44,884,901 A280D probably damaging Het
Mep1b C A 18: 21,100,051 A703E probably benign Het
Morn5 T A 2: 36,054,978 N71K probably benign Het
Mtmr10 T A 7: 64,320,627 Y373N possibly damaging Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ncbp1 G C 4: 46,155,756 V302L probably benign Het
Notch4 A G 17: 34,582,546 T1123A possibly damaging Het
Nudt18 T A 14: 70,579,012 M88K possibly damaging Het
Olfr1452-ps1 A T 19: 13,016,733 D170V possibly damaging Het
Olfr212 T A 6: 116,516,671 L298Q probably damaging Het
Olfr361 A G 2: 37,085,596 S51P possibly damaging Het
Olfr967 A T 9: 39,750,491 Y35F possibly damaging Het
Pdcd6ip T C 9: 113,659,885 N694S probably benign Het
Pecam1 T A 11: 106,688,947 T430S probably benign Het
Plaa T G 4: 94,574,051 T530P probably benign Het
Ppfia3 G T 7: 45,360,595 Q95K probably damaging Het
Ppp4r2 T C 6: 100,866,313 S331P probably benign Het
Prg4 T C 1: 150,458,263 T117A possibly damaging Het
Prrc2b A T 2: 32,213,519 D1003V probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rasef T C 4: 73,780,389 I12V probably benign Het
Robo2 T G 16: 74,352,616 Y108S probably damaging Het
Rp1 T A 1: 4,206,791 E762V unknown Het
Rsg1 A T 4: 141,219,848 Y180F probably benign Het
Rsrc1 T C 3: 66,994,654 S46P unknown Het
Rttn A T 18: 89,009,422 T554S probably benign Het
Sall3 C T 18: 80,974,099 V205M probably damaging Het
Scn3a C A 2: 65,497,600 V849L probably damaging Het
Sec23a A G 12: 58,992,283 C277R probably benign Het
Sf3b3 C T 8: 110,813,007 A1075T possibly damaging Het
Sfxn5 T C 6: 85,332,384 D113G unknown Het
Slc22a22 C T 15: 57,263,480 M64I probably benign Het
Slc5a11 C T 7: 123,258,446 P253S probably damaging Het
Smarcd3 A G 5: 24,593,069 F449S probably damaging Het
Sspo C T 6: 48,460,379 T1357M probably damaging Het
Styx C T 14: 45,372,416 T179I probably benign Het
Syt7 A T 19: 10,435,599 T297S probably benign Het
Tbx19 T A 1: 165,160,566 probably benign Het
Tg T A 15: 66,673,543 V149E probably damaging Het
Tgfbr3l T A 8: 4,249,238 L35Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem219 T A 7: 126,891,803 T161S probably damaging Het
Tox2 T A 2: 163,320,581 L68H Het
Trim5 T A 7: 104,278,474 D153V possibly damaging Het
Ttn T C 2: 76,750,307 Y23414C probably damaging Het
Ttn A T 2: 76,751,809 N22913K probably damaging Het
Ubr2 A C 17: 46,955,853 M1124R possibly damaging Het
Vmn2r75 A G 7: 86,166,360 S99P probably damaging Het
Wdr83 T C 8: 85,076,051 D219G probably damaging Het
Wdr90 C T 17: 25,849,649 V1285M probably damaging Het
Zmynd15 A T 11: 70,460,755 L62F probably damaging Het
Other mutations in Dcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dcc APN 18 71384225 critical splice acceptor site probably null
IGL00781:Dcc APN 18 71809195 missense probably benign 0.25
IGL00818:Dcc APN 18 71955012 missense probably benign
IGL00895:Dcc APN 18 71810800 missense probably damaging 0.98
IGL00969:Dcc APN 18 71456883 missense probably benign 0.25
IGL01019:Dcc APN 18 71809090 missense probably benign 0.00
IGL01132:Dcc APN 18 71682174 nonsense probably null
IGL01349:Dcc APN 18 71370737 missense probably damaging 1.00
IGL01355:Dcc APN 18 71809114 missense probably benign 0.00
IGL01374:Dcc APN 18 71374553 missense probably damaging 1.00
IGL01947:Dcc APN 18 71826209 missense probably benign
IGL02470:Dcc APN 18 71955082 splice site probably benign
IGL02508:Dcc APN 18 71370702 missense probably benign 0.00
IGL02999:Dcc APN 18 71378678 missense possibly damaging 0.68
IGL03034:Dcc APN 18 71575143 nonsense probably null
IGL03118:Dcc APN 18 71420273 missense probably benign 0.00
IGL03133:Dcc APN 18 71262955 splice site probably benign
IGL03357:Dcc APN 18 71327554 missense probably damaging 1.00
Hyperrev UTSW 18 71259015 missense probably damaging 1.00
LCD18:Dcc UTSW 18 72297447 intron probably benign
P0031:Dcc UTSW 18 71384228 splice site probably benign
PIT4142001:Dcc UTSW 18 71384226 splice site probably null
R0076:Dcc UTSW 18 71321046 nonsense probably null
R0355:Dcc UTSW 18 71575208 missense possibly damaging 0.75
R0370:Dcc UTSW 18 71587985 missense possibly damaging 0.92
R0383:Dcc UTSW 18 71420263 missense probably damaging 0.99
R0541:Dcc UTSW 18 71259015 missense probably damaging 1.00
R0690:Dcc UTSW 18 71809204 splice site probably benign
R0762:Dcc UTSW 18 71342705 splice site probably benign
R0765:Dcc UTSW 18 71362990 missense probably damaging 1.00
R0846:Dcc UTSW 18 71826212 missense probably benign 0.06
R1230:Dcc UTSW 18 71682313 missense probably damaging 1.00
R1662:Dcc UTSW 18 71420338 missense probably benign 0.00
R1663:Dcc UTSW 18 71826052 missense probably damaging 1.00
R1697:Dcc UTSW 18 71370737 missense probably damaging 1.00
R1770:Dcc UTSW 18 71446399 missense probably benign 0.01
R1781:Dcc UTSW 18 71378717 missense probably benign 0.41
R1797:Dcc UTSW 18 71367161 missense probably damaging 1.00
R2101:Dcc UTSW 18 71810870 missense possibly damaging 0.62
R2190:Dcc UTSW 18 71547420 missense possibly damaging 0.89
R2248:Dcc UTSW 18 71826168 missense probably benign 0.00
R2262:Dcc UTSW 18 71374551 missense probably damaging 1.00
R2442:Dcc UTSW 18 71456883 missense probably damaging 0.98
R3844:Dcc UTSW 18 71826186 missense probably benign 0.01
R4037:Dcc UTSW 18 72350397 missense possibly damaging 0.57
R4085:Dcc UTSW 18 71826169 missense probably benign 0.00
R4344:Dcc UTSW 18 71374490 missense probably damaging 0.99
R4499:Dcc UTSW 18 71547317 missense probably benign 0.07
R4611:Dcc UTSW 18 71548998 splice site probably null
R4811:Dcc UTSW 18 71299483 missense probably benign 0.31
R4937:Dcc UTSW 18 71542249 nonsense probably null
R5125:Dcc UTSW 18 71456877 missense probably benign 0.02
R5292:Dcc UTSW 18 71306088 missense probably damaging 1.00
R5297:Dcc UTSW 18 71378738 missense probably benign 0.00
R5317:Dcc UTSW 18 71384155 missense possibly damaging 0.78
R5691:Dcc UTSW 18 71575083 missense probably damaging 1.00
R5693:Dcc UTSW 18 71575082 missense probably damaging 1.00
R6091:Dcc UTSW 18 71809114 missense probably benign 0.00
R6291:Dcc UTSW 18 71682167 missense probably benign 0.06
R6307:Dcc UTSW 18 71810755 missense probably benign 0.15
R6343:Dcc UTSW 18 71336035 missense probably damaging 1.00
R6508:Dcc UTSW 18 71306073 missense probably damaging 1.00
R6701:Dcc UTSW 18 71809120 missense probably benign 0.02
R6810:Dcc UTSW 18 71370693 missense probably damaging 0.99
R7172:Dcc UTSW 18 71378684 missense probably benign 0.04
W0251:Dcc UTSW 18 71826083 missense probably damaging 1.00
X0020:Dcc UTSW 18 71321100 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAGTACAGTAGTGTGAATAAGTTGC -3'
(R):5'- ATTCATTAAAGGGCTGAAGTGTGC -3'

Sequencing Primer
(F):5'- CAGTAGTGTGAATAAGTTGCCTATG -3'
(R):5'- GCTTCTATGAATGAGTGTCTAACG -3'
Posted On2019-05-15